Skip to main content
Addgene
Showing: 841 - 860 of 914 results
  1. March for Science

    Type
    Blog Post
    ...Additionally, interest groups are often pandered to when strong or overlooked when small, but data is not going...
  2. Typing CRISPR Systems

    Type
    Blog Post
    ..., well understood, and the first taught when introducing CRISPR as a technology. There are three subtypes...
  3. Retrovirus Guide

    Type
    Guide
    ...Glossary γ-Retroviral Packaging Systems The widespread use of γ-retroviruses (gamma-retroviruses) in cancer...provides the widest tropism or range of cells a virus can infect. Overview of Retroviral Plasmid System Note...flexibility to pseudotype γ-retrovirus using different envelopes to modify tropism. Briefly, different envelope...either an ecotropic envelope, Phoenix-ECO, (for infection of mouse and rat cells), or an amphotropic envelope...pseudotyping. Retroviral Packaging Methods Return to Top Frequently Asked Questions (FAQ) about γ-Retroviral Plasmids...MoMLV and MSCV for γ-retrovirus; HIV for lentivirus). Additionally, γ-retroviruses can only transduce dividing... Are γ-retroviruses self-inactivating (SIN)? They can be. Plasmids that encode SIN γ-retrovirus lack most...
  4. Sequencing Primers

    Type
    Guide
    ...beta-globin intron, forward primer Bglob-intron-R TTTGCCCCCTCCATATAACA Rabbit beta-globin intron, reverse...TAGAAGGCACAGTCGAGG (Invitrogen) Bovine growth hormone terminator, reverse primer Bglob-intron-F CTGGTCATCATCCTGCCTTT...CCCAGTCACGACGTTGTAAAACG (Invitrogen) In lacZ gene M13/pUC Reverse AGCGGATAACAATTTCACACAGG (Invitrogen) In lacZ gene...AAATGATAACCATCTCGC (Invitrogen) Polyhedrin promoter, forward primer Polyhedrin reverse GTCCAAGTTTCCCTG (Invitrogen) For...Used Primers CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward ...Full Primer List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse...reverse primer 5'AOX1 GACTGGTTCCAATTGACAAGC (Invitrogen) For Pichia vectors with AOX1 promoter, forward...
  5. Lentiviral Guide

    Type
    Guide
    ...between a lentivirus and a retrovirus? Lentiviruses are a subtype of retrovirus. From an experimental standpoint...difference between lentiviruses and standard retroviruses (γ-retroviruses) is that lentiviruses are capable of...variety of cell types than retroviruses. Both lentiviruses and standard retroviruses use the gag, pol, and ...dictates lentiviral host cell range (tropism)? Lentiviral tropism is determined by the ability of the ...of Transgenes Delivered by Retroviral Vectors. Zufferey R, Donello JE, Trono D, and Hope TJ. J Virol. 1999... D, Naldini L, and Trono D. J Virol. 1998. 72(12): 9873-9880. PubMed . Retroviruses. Coffin JM, Hughes...protocol available at the (Link opens in a new window) Trono lab website . Viral Production Schematic Frequently...
  6. Antibody Guide

    Type
    Guide
    ...negative control. The negative control may be a no-antibody control in which a sample is processed without ...standard curve can serve as the positive control); and a negative control, a sample known not to contain your...interest. The negative control should be biological (no protein expressed), which controls for your antibody...fragmentation of the DNA. Controls for capture methods Capture methods should use a positive control and a negative...addition to the control used in standard IP, ChIP should additionally use a beads-only control which runs ...the machine. Controls for cell sorting methods Flow cytometry requires a negative control, a small subset...animal’s immune system. The antigen of interest is introduced to the animal, which then mounts an immune response...
  7. Optogenetics Guide

    Type
    Guide
    ...Optogenetics Guide Introduction Microbial Opsins Optical Switches References Introduction The field of optogenetics...research utilize light to detect, measure, and control molecular signals and cells in order to understand... genetically-encoded tools for light-activated control of proteins; e.g., microbial opsins and optical...These various opsins also initiate different electrochemical responses, such as nonspecific cation influx...subsets of neurons, allowing precise spatiotemporal control of these neurons by turning on and off the light...Wild-type halorhodopsin, known as NpHR (from Natronomonas pharaoni ), causes hyperpolarization (inhibition.../NpHR Light-driven inward chloride pump from Natronomonas pharaonis , used to silence neuronal activity...
  8. Molecular Biology Reference

    Type
    Guide
    ...is also important for controlling the level of insert expression (i.e., a strong promoter directs high...BL21 Invitrogen; New England BioLabs E. coli B F dcm ompT hsdS(rB mB) gal ccdB Survival Invitrogen F- mcrA...Genetics Plasmid Elements Working with Plasmids Introduction Types of Plasmids E. coli strains for propagating...genes as carriers of phenotypic information was introduced in the early 19th century by Gregor Mendel, who...of restriction enzymes, DNA ligase, and gel electrophoresis allowed for the ability to move specific fragments...that the antibiotic resistance gene is under the control of a bacterial promoter, and is thus expressed ...antibiotic resistance gene (this time, under the control of a non-bacterial promoter) or a fluorescent protein...
  9. Promoters

    Type
    Guide
    ...Transcription is tightly controlled in both bacteria and eukaryotes. Promoters are controlled by various DNA regulatory...Constitutive Strong mammalian promoter from human cytomegalovirus EF1a Constituitve Strong mammalian promoter...vital component of expression vectors because they control the binding of RNA polymerase to DNA. RNA polymerase...a functional protein. Thus the promoter region controls when and where in the organism your gene of interest... are proteins which recruit RNA polymerase and control and regulate the transcription of DNA into mRNA...human elongation factor 1 alpha CAG Constitutive Strong hybrid mammalian promoter PGK Constitutive Mammalian...consists of the sequence TTGACA and this element controls the rate of transcription. Bacterial cells contain...
  10. CRISPR Guide

    Type
    Guide
    ...provide a basic understanding of CRISPR biology, introduce the various applications of CRISPR, and help you...research. CRISPR Basics In this section, we will introduce the basic mechanisms of CRISPR and some of the...increase nuclease fidelity SpCas9-NG - NG; increase in vitro activity SpG - NGN; increase nuclease activity SpRY...-occurring Acr (Anti-CRISPR) proteins can help control CRISPR activity. Acr proteins have evolved in phages...LmoCas9 and SpCas9. Acr proteins can be used to control both when and where genome editing happens. CASANOVA...Dominik Niopek’s lab , is a way to optogenetically control genome editing by fusing the anti-CRISPR protein...photosensitive LOV2 domain . Several labs have also controlled Acr activity with endogenous cell-type specific...
  11. Chemogenetics Guide

    Type
    Guide
    ... However, neuronal control through PSAMs and LMOs is direct, while neuronal control of DREADDs is indirect...endogenous signaling, therefore allowing precise control over the cell population they are targeted to. ...used in the same organism to allow bidirectional control of neuronal activity. Table 1. Descriptions of ...chemogenetic receptors that confer more direct control of neurons through manipulation of ion channels...expression of AAV-delivered constructs can be controlled with cell-type specific promoters. Table 4 lists...unwanted cell types. Generating a FLEx switch to control expression of a chemogenetic reporter ensures that...AI, Armbruster BN, Pei Y, et al. (2009). Remote control of neuronal activity in transgenic mice expressing...
  12. Guide to Using Pooled Libraries

    Type
    Guide
    ...Library Guide Introduction Library Amplification Types of Screens Resources An Introduction to Pooled Libraries...the screening process. Amplify the library (electroporation and maxiprep). If delivering as virus, make... Perform Next Generation Sequencing (NGS) on a control sample (no selection) In parallel, apply library...cells Compare NGS results between experimental and control cells Generate a list of gRNAs that disappear with... post-selection. The selective pressure must be strong enough that most of the cells die, removing their...selection while the other serves as a non-selected control. These two populations are then sequenced using...Screening Pooled CRISPR Libraries Offer Genome-Wide Control for Large-Scale Functional Screens New Tool for...
  13. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...used being AAV2. These serotypes differ in their tropism, or the types of cells they infect, making AAV ... types. The chart below gives a summary of the tropism of AAV serotypes, indicating the optimal serotype...Pseudotyping Researchers have further refined the tropism of AAV through pseudotyping, or the mixing of a...improve transduction efficiency, as well as alter tropism. For example, AAV2/5 targets neurons that are not...multiple different serotypes, which also alter viral tropism. One common example is AAV-DJ, which contains a...AAV-DJ displays a higher transduction efficiency in vitro than any wild type serotype; in vivo , it displays...Plasmid Video Web References Vector Biolabs: Introduction to AAV University of South Carolina's Viral ...
Showing: 841 - 860 of 914 results