Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 17 results for: Tro;

Showing: 1 - 17 of 17 results

  1. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...Read our gamma-retroviral guide to learn about gamma-retroviral components, retroviral production, and...Guides Gamma-Retroviral Vector Guide Gamma-Retroviral Vector Guide Jump To: Gamma-Retroviral Vectors Vector...Glossary Gamma-retroviruses are a subtype of retrovirus and belong to the Retroviridae family. Gamma-retrovirus...Lentiviruses and gamma-retroviruses fall under the Retroviridae family. The genome of retroviruses is made of RNA...known as tropism). Figure 2: Gamma-retroviral plasmids. Created with BioRender.com. Gamma-Retroviral Vector...Definition Gamma-retrovirus A retrovirus from the Retroviridae family. Characterized by long incubation...decades. Wildtype gamma-retroviruses have been engineered into gamma-retroviral vectors that can be safely...

  2. Sequencing Primers

    Type
    Guide
    ...beta-globin intron, forward primer Bglob-intron-R TTTGCCCCCTCCATATAACA Rabbit beta-globin intron, reverse...TAGAAGGCACAGTCGAGG (Invitrogen) Bovine growth hormone terminator, reverse primer Bglob-intron-F CTGGTCATCATCCTGCCTTT...CCCAGTCACGACGTTGTAAAACG (Invitrogen) In lacZ gene M13/pUC Reverse AGCGGATAACAATTTCACACAGG (Invitrogen) In lacZ gene...AAATGATAACCATCTCGC (Invitrogen) Polyhedrin promoter, forward primer Polyhedrin reverse GTCCAAGTTTCCCTG (Invitrogen) For...Used Primers CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward ...Full Primer List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse...reverse primer 5'AOX1 GACTGGTTCCAATTGACAAGC (Invitrogen) For Pichia vectors with AOX1 promoter, forward...

  3. Lentiviral Vector Guide

    Type
    Guide
    ... Versus Gamma-Retrovirus Lentiviruses and gamma-retroviruses fall under the Retroviridae family. The genome...Glossary Lentiviruses are a type of retrovirus and belong to the Retroviridae family. Infection with lentiviruses...variety of cell types than retroviruses. Both lentiviruses and gamma-retroviruses use the same packaging ...packaged by gamma-retroviral packaging systems, and vice versa. For more about gamma-retroviruses, see Addgene's...Panch, S. R., Jin, P., & Stroncek, D. F. (2022). Genome-wide profiling of retroviral DNA integration and its..., leading to disease. Lentivirus A retrovirus from the Retroviridae family. Characterized by long incubation...BIV), and feline immunodeficiency virus (FIV). Retroviruses are partially characterized by their ability...

  4. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...studied, and has a broad tissue tropism. Table 1 gives a summary of the tropism of AAV serotypes, indicating...variant able to display neuronal retrograde transport, AAVrg. Retrograde transport refers to the direction...disease, spinal muscular atrophy, hemophilia A and B, and Duchenne muscular dystrophy. Many clinical trials...injection. Different AAV serotypes exhibit strong neuronal tropism, meaning they can efficiently target specific...therefore non-pathogenic and generally do not trigger a strong immune response. These features have made AAVs ...are transfected into cells which then act as in vitro factories for the new viral particles in the laboratory...serotypes are AAV variants that differ in their tropism — that is, the types of cells they infect. Serotypes...

  5. Antibody Guide

    Type
    Guide
    ...negative control. The negative control may be a no-antibody control in which a sample is processed without ...standard curve can serve as the positive control); and a negative control, a sample known not to contain your...interest. The negative control should be biological (no protein expressed), which controls for your antibody...fragmentation of the DNA. Controls for capture methods Capture methods should use a positive control and a negative...addition to the control used in standard IP, ChIP should additionally use a beads-only control which runs ...the machine. Controls for cell sorting methods Flow cytometry requires a negative control, a small subset...animal’s immune system. The antigen of interest is introduced to the animal, which then mounts an immune response...

  6. Optogenetics Guide

    Type
    Guide
    ...Optogenetics Guide Introduction Microbial Opsins Optical Switches References Introduction The field of optogenetics...research utilize light to detect, measure, and control molecular signals and cells in order to understand... genetically-encoded tools for light-activated control of proteins; e.g., microbial opsins and optical...These various opsins also initiate different electrochemical responses, such as nonspecific cation influx...subsets of neurons, allowing precise spatiotemporal control of these neurons by turning on and off the light...Wild-type halorhodopsin, known as NpHR (from Natronomonas pharaoni ), causes hyperpolarization (inhibition.../NpHR Light-driven inward chloride pump from Natronomonas pharaonis , used to silence neuronal activity...

  7. Molecular Biology Reference

    Type
    Guide
    ...is also important for controlling the level of insert expression (i.e., a strong promoter directs high...BL21 Invitrogen; New England BioLabs E. coli B F dcm ompT hsdS(rB mB) gal ccdB Survival Invitrogen F- mcrA...Genetics Plasmid Elements Working with Plasmids Introduction Types of Plasmids E. coli strains for propagating...genes as carriers of phenotypic information was introduced in the early 19th century by Gregor Mendel, who...of restriction enzymes, DNA ligase, and gel electrophoresis allowed for the ability to move specific fragments...that the antibiotic resistance gene is under the control of a bacterial promoter, and is thus expressed ...antibiotic resistance gene (this time, under the control of a non-bacterial promoter) or a fluorescent protein...

  8. Promoters

    Type
    Guide
    ...Transcription is tightly controlled in both bacteria and eukaryotes. Promoters are controlled by various DNA regulatory...Constitutive Strong mammalian promoter from human cytomegalovirus EF1a Constituitve Strong mammalian promoter...vital component of expression vectors because they control the binding of RNA polymerase to DNA. RNA polymerase...a functional protein. Thus the promoter region controls when and where in the organism your gene of interest... are proteins which recruit RNA polymerase and control and regulate the transcription of DNA into mRNA...human elongation factor 1 alpha CAG Constitutive Strong hybrid mammalian promoter PGK Constitutive Mammalian...consists of the sequence TTGACA and this element controls the rate of transcription. Bacterial cells contain...

  9. Adenovirus Guide

    Type
    Guide
    ...Addgene's Blog An Introduction to Adenovirus Adenoviral Vector Production and Troubleshooting Adenoviral Delivery...recognizes adenoviral elements rapidly and can mount a strong immune response quickly, which has limited their...double-stranded circular episomes. Due to this, and to the strong host’s immune response against the transduced cells...G). Different serotypes exhibit varying tissue tropisms, meaning they preferentially infect certain tissues...proteins. Researchers have further refined the tropism of rAdV vectors by mixing capsids and genomes from...vector features such as transduction efficiency, tropism and immunogenicity. For example, Ad5/35 and Ad5...viral vector uptake and transgene expression. This strong immune response has become a disadvantage for the...

  10. CRISPR Guide

    Type
    Guide
    ...provide a basic understanding of CRISPR biology, introduce the various applications of CRISPR, and help you...research. CRISPR Basics In this section, we will introduce the basic mechanisms of CRISPR and some of the...increase nuclease fidelity SpCas9-NG - NG; increase in vitro activity SpG - NGN; increase nuclease activity SpRY...-occurring Acr (Anti-CRISPR) proteins can help control CRISPR activity. Acr proteins have evolved in phages...LmoCas9 and SpCas9. Acr proteins can be used to control both when and where genome editing happens. CASANOVA...Dominik Niopek’s lab , is a way to optogenetically control genome editing by fusing the anti-CRISPR protein...photosensitive LOV2 domain . Several labs have also controlled Acr activity with endogenous cell-type specific...

  11. Chemogenetics Guide

    Type
    Guide
    ... However, neuronal control through PSAMs and LMOs is direct, while neuronal control of DREADDs is indirect...endogenous signaling, therefore allowing precise control over the cell population they are targeted to. ...used in the same organism to allow bidirectional control of neuronal activity. Table 1. Descriptions of ...chemogenetic receptors that confer more direct control of neurons through manipulation of ion channels...expression of AAV-delivered constructs can be controlled with cell-type specific promoters. Table 4 lists...unwanted cell types. Generating a FLEx switch to control expression of a chemogenetic reporter ensures that...AI, Armbruster BN, Pei Y, et al. (2009). Remote control of neuronal activity in transgenic mice expressing...

  12. Guide to Using Pooled Libraries

    Type
    Guide
    ...Library Guide Introduction Library Amplification Types of Screens Resources An Introduction to Pooled Libraries...the screening process. Amplify the library (electroporation and maxiprep). If delivering as virus, make... Perform Next Generation Sequencing (NGS) on a control sample (no selection) In parallel, apply library...cells Compare NGS results between experimental and control cells Generate a list of gRNAs that disappear with... post-selection. The selective pressure must be strong enough that most of the cells die, removing their...selection while the other serves as a non-selected control. These two populations are then sequenced using...Screening Pooled CRISPR Libraries Offer Genome-Wide Control for Large-Scale Functional Screens New Tool for...

  13. Plan Your Experiment

    Type
    Guide
    ...viral delivery RNA delivery of Cas9 and gRNA In vitro transcription reactions generate mature Cas9 mRNA... to target cells through microinjection or electroporation Transient expression of CRISPR components Expression...ribonucleoprotein (RNP) complexes Purified Cas9 protein and in vitro transcribed gRNA are combined to form a Cas9-gRNA...repaired DSBs): For small nucleotide edits that introduce a novel restriction site. The region of interest...identify DNA fragments. PCR amplification and gel electrophoresis (for HDR or NHEJ): For large deletions or insertions...25408407 Hashimoto, M., & Takemoto, T. (2015). Electroporation enables the efficient mRNA delivery into the...enables efficient protein-based genome editing in vitro and in vivo. Nature Biotechnology . 33 (1), 73–80...

  14. Science Guides

    Type
    Guide
    ...selectively control and investigate cell signaling pathways. Receptors are remotely controlled via small...small molecules, which allows for specific control of activity. Read More CRISPR Class 2 C lustered R egularly...research utilize light to detect, measure, and control molecular signals and cells in order to understand...Lentivirus Adeno-associated Virus (AAV) Adenovirus γ-Retrovirus Read More...

  15. Addgene's eBook Collection

    Type
    Guide
    ...biosensors, and monitoring protein localization; an introduction to non-protein fluorophores; and much more! ...About This guide to viral vectors contains an introduction to each vector and its applications, tips for...for using vectors in your experiments, troubleshooting advice on production and use, and much more! Close...Edition, trans. About Una traducción al español de nuestro libro electrónico, CRISPR 101. Close About Overlay...Edition About Our newest eBook contains practical introductions and helpful tips for antibody-based applications...

  16. Cloning

    Type
    Guide
    ...principle to Gibson cloning, but instead of an in vitro reaction with purified enzymes, it takes advantage... manner. To accomplish this, you just need to introduce into the yeast the two (or more) fragments of ...

  17. Educational Resources

    Type
    Guide
    ...plasmid cloning, and virus, including: Gel Electrophoresis Bacterial Transformation Plasmid Cloning Creating...
Showing: 1 - 17 of 17 results