We narrowed to 964 results for: TES
-
TypeBlog Post...the world is unprepared. Each year in the United States, two million people will be infected by antibiotic...
-
Interview: Hodaka Fujii on enChIP, New CRISPR Tools, and More
TypeBlog Post...early research career. I've found that research institutes in different places have very different cultures... -
Your Lentiviral Plasmid FAQs Answered
TypeBlog Post...envelope plasmid you use as the choice of envelope dictates the tropism of the virus. VSV-G is very common... -
Viral Vectors 101: Preparing Pooled Libraries
TypeBlog Post...amplification. Transformed E. coli are allowed to grow on plates or in liquid culture to amplify the library, followed... -
Twenty Years of Sharing: Addgene's Viral Vector Service
TypeBlog Post...protein tools that are activated, respectively, by substrates, light, or engineered ligands (Figure 2). Biosensors... -
How to Write a Scientific Review Article
TypeBlog Post...was most productive in short bursts (even twenty minutes was enough to make some progress). For most researchers... -
Plasmids 101: Plasmid Incompatibility
TypeBlog Post...machinery (Novick, 1987). In cases where one plasmid outcompetes the other, usually a smaller, higher copy plasmid... -
5 Reasons to Use Reddit for Science Communication
TypeBlog Post...too many to describe here, but I have over 2,000 notes which Evernote even allows me to access on my phone... -
CRISPR Activation: A Practical Guide
TypeBlog Post...you want to activate, you should also be ready to test three or four guides directed towards that gene ... -
Viral Vectors 101: Integrase-Deficient Lentiviral Vectors
TypeBlog Post...vesicular stomatitis virus G protein (VSV-G), which facilitates viral entry into the host cell. Transfecting... -
CRISPR 101: Engineering the Plant Genome Using CRISPR/Cas9
TypeBlog Post...doi.org/10.1038/s41565-019-0375-4 Lowder LG, Zhang D, Baltes NJ, Paul JW III, Tang X, Zheng X, Voytas DF, Hsieh... -
Viral Vectors 101: AAV Serotypes and Tissue Tropism
TypeBlog Post...transduce neurons for retrograde labeling, as well as astrocytes in the CNS (Han et al., 2023), and has also been... -
Plasmids 101: Repressible Promoters
TypeBlog Post... the strong yeast promoter pTEF). As ethanol accumulates, it binds to the repressor, enabling it to bind... -
Science Guides
TypeGuide...experiment. Read More Optogenetics Optogenetics integrates optics and genetic engineering to measure and... -
Typing CRISPR Systems
TypeBlog Post... clustering and discovery algorithms find new candidates for CRISPR proteins. A type VII is already on... -
Guide to Using Pooled Libraries
TypeGuide...maxiprep). If delivering as virus, make virus; this creates a pooled lentiviral CRISPR library. Apply pooled... -
How to Deposit Your Plasmids with Addgene
TypeBlog Post...descriptions first before entering the data. This step associates an Addgene ID with your plasmids, and adding ... -
Sequencing Primers
TypeGuide...Forward pAd-CMV GCTAGAGATCTGGTACCGTC For cloning sites after SalI in pAd-CMV vector Forward pBABE 3' ACCCTAACTGACACACATTCC... -
Protocol - How to Design Primers
TypeProtocol...also needs to avoid primer-primer annealing which creates primer dimers and disrupts the amplification process... -
Protocol - How to Create a Bacterial Glycerol Stock
TypeProtocol...2 mL screw top tube or cryovial and gently mix. Notes: Make the 50% glycerol solution by diluting 100%...