We narrowed to 954 results for: TES

...doi.org/10.1038/s41565-019-0375-4 Lowder LG, Zhang D, Baltes NJ, Paul JW III, Tang X, Zheng X, Voytas DF, Hsieh...

... the strong yeast promoter pTEF). As ethanol accumulates, it binds to the repressor, enabling it to bind...

...transduce neurons for retrograde labeling, as well as astrocytes in the CNS (Han et al., 2023), and has also been...

... clustering and discovery algorithms find new candidates for CRISPR proteins. A type VII is already on...

...experiment. Read More Optogenetics Optogenetics integrates optics and genetic engineering to measure and...

...descriptions first before entering the data. This step associates an Addgene ID with your plasmids, and adding ...

...maxiprep). If delivering as virus, make virus; this creates a pooled lentiviral CRISPR library. Apply pooled...

...Forward pAd-CMV GCTAGAGATCTGGTACCGTC For cloning sites after SalI in pAd-CMV vector Forward pBABE 3' ACCCTAACTGACACACATTCC...

...also needs to avoid primer-primer annealing which creates primer dimers and disrupts the amplification process...

...2 mL screw top tube or cryovial and gently mix. Notes: Make the 50% glycerol solution by diluting 100%...

... Agar Plate You may also like... Making LB Agar Plates Bacterial Transformation Recovering Plasmid DNA...

...lots of FBS can promote or inhibit transfection. Test a variety of brands and lots of FBS to find one ...

... in a final concentration of 10% bleach for 30 minutes before pouring down the drain. Solid BSL-2 waste...

...PES filter or centrifugation at >500 x g for 5 minutes. Do not use the medium if the cells are overly ...