We narrowed to 94 results for: 158
-
TypeBlog Post...vectors (containing ten guides against each of the 8,158 predicted T. gondii protein-coding genes). Dr. Lourido...
-
CRISPR Guide
TypeCollection...with Bacteriophage Proteins. Cell , 168 (1–2), 150-158.e10. PMID: 28041849 Sakuma, T., Nishikawa, A., Kume...-binding proteins. Genome Research . 25 (10), 1581–1589. PMID: 26355004 Tanenbaum, M. E., Gilbert, L. ... -
CRISPR Plasmids - Parasites
TypeCollection... pooled library designed with 10 guides against 8,158 predicted protein-coding genes. Do you have suggestions... -
TALENs for Endogenous Zebrafish Genes
TypeCollection...TGGTGTAACAGTGAAAGAcgtcaaccagcaggagTTTGTCCGGGCGCTGGCA ryr2b TAL3158 & TAL3159 TATCTGCAGCCTTTCCCGtgtgtttcttggagctGAGTGACCTTCATTCTCA... -
Optogenetics AAV Preps
TypeCollection... red-shifted) GCaMP6m Constitutive 8 Deisseroth 137158 pAAV-nEF-ChRmine-mScarlet nEF ChRmine (high-photocurrent... -
Deisseroth INTRSECT Collection
TypeCollection...pAAV-nEF-Coff/Fon-bREACHes-EYFP Flp AND NOT Cre No 137158 pAAV-nEF-ChRmine-mScarlet None Yes 137159 pAAV-... -
CRISPR History and Development for Genome Engineering
TypeCollection...ChIP-seq of DNA-binding proteins. Genome Res . 25(10):1581-9. PMID: 26355004 Shalem O, Sanjana NE, Hartenian... -
CRISPR Pooled gRNA Libraries
TypeCollection...Knockout 80636 Knockout T. gondii Lourido N/A 10 8,158 TUNEYALI Library 217744 Knockout Yeast Borodina ... -
Plasmids for Stem Cell Research
TypeCollection...Reprogramming Human Fibroblasts. Cell Rep. 2017 Aug 15;20(7):1585-1596. Ptashne Minicircle Human Non-integrating mini-intronic... -
Plan Your Experiment
TypeCollection...Biotechnology , 38 (7), 813–823. https://doi.org/10.1038/s41587-020-0490-7 PMID: 29305085 Hashimoto, M., & Takemoto... -
Genetic Code Expansion
TypeCollection...Bacterial, Plant TAG Chang Liu 85484 pDule-tfmF A65V S158A tri-fluoromethyl-phenylalanine synthetase M. jannaschii... -
Validated gRNA Sequences
TypeCollection...pyogenes 23849981 Qi GAL4UAS TGGGGACAGTACTCCGCTCGAGT 64158 activate S. pyogenes 25619936 Sato GAL4UAS TGGGTCTTCGGAGGACAGTACTC... -
Plan Your Experiment
TypeGuide...Biotechnology , 38 (7), 813–823. https://doi.org/10.1038/s41587-020-0490-7 PMID: 29305085 Hashimoto, M., & Takemoto... -
Adenovirus Guide
TypeGuide... Vaccines, 14 (10), 1347–1357. https://doi.org/10.1586/14760584.2015.1077122 (Link opens in a new window...