We narrowed to 92 results for: Cre recombinase
-
TypeCollection...Isocortex 230803 pAAV-AiE2638m-minBG-iCre(R297T)-BGHpA AiP20142 AiE2638m Cre Layer 2-3_IT Isocortex 214583 pAAV-AiE2543m-minBG-SYFP2...Isocortex 220727 pAAV-AiE2543m-minBG-iCre(R297T)-BGHpA AiP2048 AiE2543m Cre Layer 2-3_IT Isocortex 224004 pAAV-AiE0680m-minBG-SYFP2...Isocortex 230402 pAAV-AiE0680m-minBG-iCre(R297T)-BGHpA AiP15072 AiE0680m Cre Layer 2-3_IT Isocortex 223974 pAAV-AiE0050m...224056 pAAV-AiE0050m_3xC2-minBG-iCre(R297T)-BGHpA AiP13152 AiE0050m_3xC2 Cre Layer 4_IT Isocortex 224038 ...220734 pAAV-AiE0671m_3xC2-minBG-iCre(R297T)-BGHpA AiP20026 AiE0671m_3xC2 Cre Layer 4_IT Isocortex 224043 ...220735 pAAV-AiE2182m_3xC2-minBG-iCre(R297T)-BGHpA AiP20027 AiE2182m_3xC2 Cre Layer 5_IT Isocortex 214522 ...229920 pAAV-AiE0459m_3xC2-minBG-iCre(R297T)-BGHpA AiP14187 AiE0459m_3xC2 Cre Layer 5_ET Isocortex 224013 ...
-
CRISPR References and Information
TypeCollection... (pharyngeal co-injection marker); pDD104 (Cre recombinase) PDF, 105 KB Jaenisch CRISPR plasmid summary...- a CRISPR Screen Tool (Link opens in a new window) Design gRNAs for custom CRISPR screens targeting a...in your lab, from knockouts to pooled library screening. CRISPR eBook Addgene's downloadable eBook about...CRISPR pooled libraries for large-scale functional screens. Available for knockout, activation, inhibition...For use with genome-scale CRISPR-Cas9 knockout screens (or GeCKO) technology. Developed by the Xiaole ...batch (Link opens in a new window) for lentiviral screens. sgRNA Scorer 2.0 (Link opens in a new window) ...considerations, and more. CasPEDIA is a community resource created and maintained by the Jennifer Doudna Lab . Read... -
Delivery Methods for Generating iPSCs
TypeBlog Post...lentiviral vector, but transient expression of Cre recombinase allows for deletion of the inserted transgenes...formation in iPSC-derived and iPSC-transplanted mice. Cre-deletable or Tet-inducible lentiviruses address some...considered safe for clinical applications. Excisable Cre-lox lentiviral vectors: This approach is the same...insertional mutagenesis. Random integration also creates heterogeneous iPSC cell lines, which can complicate...insertional mutagenesis and random integration creates variation between iPSC clones. Retroviruses are...which is removed by culturing cells at 38℃, but screening cells for the presence of transgenes is still ... -
Plasmids 101: Modular Cloning Applications and Kits
TypeBlog Post...specialized system with parts including site-specific recombinases, regulatory elements, developmental regulators... technology has been used to optimize protein secretion and expression in the biotech workhorse yeast ...Engineering disease resistance through gene stacking, increasing production of a protein of interest, and improving...genetic circuits with multiplexed guides, mini screening libraries, direct edit optimization, and more....can be invaluable for more complex editing and screening experiments in organisms that don’t yet have these...modify it as necessary. And remember, if you end up creating a really cool MoClo kit, we would love for you...Modular Toolkit for Generating Pichia Pastoris Secretion Libraries.” ACS Synthetic Biology, vol. 6, no.... -
27 Hot Plasmids from 2016
TypeBlog Post...loxP-stop-loxP cassette into the Rosa26 locus, allowing for Cre-dependent expression of a GMAP inserted gene. The...species. Indeed, in order to use MAGE, the λ Red recombinase enzymes need to be expressed and the native methyl-directed...plasmids (dubbed pORTMAGE) expresses the λ Red recombinase enzymes, as well as a dominant-negative mutator...of a good screening experiment can be found on our blog post entitled “Genome-wide Screening Using CRISPR...Receptor-ome Expression and Screening via Transcriptional Output-TANGO (PRESTO-TANGO) to screen the NCC-1 library...and later create stable cell lines expressing it. The Church lab fixed this issue by creating a new dCas9... CRISPR pooled libraries enable researchers to screen the entire genome for genes that regulate a wide... -
Using AAV for Neuronal Tracing
TypeBlog Post...often made Cre-dependent. If Cre-dependent vectors are used in transgenic animals that express Cre in only...conditional mutant mouse brain that expressed Cre recombinase only in pyramidal cells of the hippocampal ...labelling the subset of infected cells that also express Cre. Another advantage of AAV vectors is that there are... traced neurons with an AAV9 vector expressing a Cre-dependent fluorescent marker. Injection into a conditional...PMID: 4107258. Lo, L., and Anderson, D.J. (2011). A Cre-dependent, anterograde transsynaptic viral tracer... -
CRISPR Guide
TypeGuide...Plasmids: CRISPR transposases CRISPR Recombinases and Integrases Recombinases, and their subfamily integrases...for large scale edits. These proteins, like Cre recombinase or phage derived serine integrases, insert ...mechanisms, including transposons, integrases, and recombinases, with Cas enzymes. CRISPR Transposases Transposon...lab , pairs prime editing with a large serine recombinase (LSR). A prime editor is used to install the ...evoBxb1 or eeBxb1 are evolved versions of the recombinase with improved integration efficiencies in mammalian...& Hsu, P. D. (2022). Systematic discovery of recombinases for efficient integration of large DNA sequences...GAT; increased nuclease fidelity SpCas9-NG — NG; increased in vitro activity SpG — NGN; increased nuclease... -
Optogenetics Guide
TypeGuide...powerful when combined with site specific recombinase technology like Cre-lox, which allows you to express an...when one half of a given protein, such as the Cre recombinase, is fused to Cry2 and the other half to CIB1...using a viral vector with a floxed opsin in a VGAT-cre animal will result in expression of the opsin only... include: Increased photocurrent amplitude Examples: ChR2(H134R), C1V1(t/t), ChIEF Increased channel (... following enhancements: Increased light sensitivity Example: ArchT Increased photocurrent amplitude Examples...Scherffelia dubia ). Synthetic variants have been created via genetic point mutations, codon optimization...Alternatively, ChR variants that inhibit neurons have been created and identified in other species. By acting as light-gated... -
Sequencing Primers
TypeGuide...immediate early promoter Forward CRE-R GCAAACGGACAGAAGCATTT 5' end of Cre recombinase Reverse CYC1 GCGTGAATGTAAGCGTGAC... -
Adenovirus Guide
TypeGuide...adenoviral production, and is driven by use of the Cre recombinase. Genome Integration Upon infection, wild-type...contamination have been developed, such as using the Cre-lox and Flp-FRT recombination systems to excise the... forward or reverse orientation, respectively. Created with BioRender.com. Adenoviruses are part of the...adenoviruses have been modified by researchers to create recombinant adenoviral (rAdV) vectors in order ...deletions. Figure 2: First-generation rAdV vectors. Created with BioRender.com. Second-generation rAdV vectors...with first-generation rAdV vectors and further increase the transgene packaging capacity up to ~10.5 kb...vectors. Figure 3: Second-generation rAdV vectors. Created with BioRender.com. Third-generation rAdV vectors... -
Molecular Biology Reference
TypeGuide...our CRISPR Guide . CRISPR Plasmids , Cre-lox and Other Recombinases , TALEN Plasmids and Kits , Genome ... into a right-handed, double-stranded helix. To create the double helix, the nucleotides on the opposing...fragments of interest, such as genes. Figure 1: Creation of recombinant DNA. Working with Plasmids Today... With current cloning technology, it is easy to create and modify plasmids containing the genetic element...vector can also include an enhancer sequence which increases the amount of protein or RNA produced. Expression...into target cells. You can use these plasmids to create viral particles (most commonly lentiviral, retroviral...method. Figure 3: Summary of Sanger sequencing. Created with BioRender.com. Next-generation Sequencing ... -
28 Hot Plasmid Technologies from 2015
TypeBlog Post...of sequence-specific enzymes (e.g. nucleases, recombinases) which irreversibly excise or invert a specific...upon these findings by screening for additional activation domains that increase the expression of target...Synchronization of secretory protein traffic in mammalian cells The journey of secretory proteins, from their... mutagenized and screened for speed and voltage sensitivity. This hierarchical screen led to the generation...has modified the RNA-guided CRISPR-Cas9 system to create a tool that is quick, versatile, and robust. Dubbed...adopt basic biological concepts and employ them in creative and innovative ways. The principle of protein ...molecule imaging and inducible gene expression by creating the SunTag system. The SunTag system, named after...