Skip to main content
Addgene

We narrowed to 562 results for: PAC

Showing: 81 - 100 of 562 results
  1. Back to Bacteria: CRISPR gRNA Multiplexing Using tRNAs

    Type
    Blog Post
    ...Cas9 multiplexing in systems with limited packaging capacity. Still confused about the various tRNA expression... will be necessary to improve its multiplexing capacity. Multiplexing is key due to the natural redundancy...often necessary. Guide RNAs (gRNAs) are commonly packaged in 400-500 bp cassettes containing the RNA pol...100 bases) limit the number of gRNAs that can be packaged together in a single vector. In addition, the ...forms tRNA-gRNA and tRNA-gRNA-tRNA, with short 5’ spacer sequences preceding gRNAs, to test for gRNA cleavage...predicted with no addition of nucleotides to the 5’ spacers. The 3’ ends were modified slightly with either...once, and each <200 bp tRNA-gRNA takes up half the space of a standard pol III-gRNA, which will facilitate...
  2. Delivery Methods for Generating iPSCs

    Type
    Blog Post
    ...nondividing cells and have an ~8kb packaging capacity. With this packaging capacity, reprogramming factors can...other delivery methods. Retrovirus has a cloning capacity of ~8 kb, so either a single polycistronic vector...or multiple single-gene vectors can be used to package reprogramming factors. An important milestone of...and nondividing cells and have a larger cloning capacity (8-10 kb) than other retroviral vectors. This ...a vector and chromosomal DNA. PB has a cloning capacity of ~9-14 kb. This system is transfected into cells...simple and fast to evaluate. iPSCs should form compact colonies that are comprised of cells with a large...differentiated in vitro to form embryoid bodies which are compact balls of loosely organized tissues that express...
  3. What's New in CRISPR - November 2021

    Type
    Blog Post
    ...system is that it is too large to be effectively packaged into AAV particles for delivery into mammalian... much smaller and would be ideal for such AAV packaging, but their activity in mammalian systems has been... based systems, making it well suited for AAV packaging. Most importantly, this CasMINI system was shown...CasMINI plasmids Efficient CRISPR editing with a hypercompact Cas12f1 and engineered guide RNAs Yong-Sam Kim...result is a highly efficient Cas system with very compact genome editors and a gRNA down-sized by almost ...specifically binds its own mRNA to facilitate its packaging into virus-like particles. Feng Zhang’s lab adapted...the native PEG10 RNA sequences to instead drive packaging of cargo sequences in the capsid, in an approach...
  4. Optogenetics AAV Preps

    Type
    Collection
    ... Viral Vector Packaging Service AAV Optogenetics Viral Vector Packaging Service: Optogenetics ...Promoter Opsin Variant Tag Activity Serotype PI 20071 pACAGW-ChR2-Venus-AAV CAG ChR2 Venus Constitutive 1, 9... Page . Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...
  5. Validated gRNA Sequences

    Type
    Collection
    ...GTTGTAGCTCCCTTTCTCATTTCG 47870 cut N. meningitidis 23940360 Thomson Protospacer A Synthetic TACCATCTCAAGCTTGTTGA 48651 cut N....N. meningitidis 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48652 cut N. meningitidis...meningitidis 24076762 Church Protospacer A Synthetic TACCATCTCAAGCTTGTTGA 48653 cut S. thermophilus 24076762 Church...Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48654 cut S. thermophilus 24076762 Church Protospacer...TACCATCTCAAGCTTGTTGA 48655 cut T. denticola 24076762 Church Protospacer B Synthetic ACTTTAAAAGTATTCGCCAT 48656 cut T....
  6. The Effect of COVID-19 on Liu Lab Plasmid Requests From Addgene Data

    Type
    Blog Post
    ... across regions, with Europe most impacted and China least impacted. The inferred weekend effect is, in...date range is, they could be the most impacted or least impacted. These results highlight the instability... last six months, COVID-19 has had a tremendous impact on our world -- as of June 4, 2020, COVID-19 has...unique PIs/labs placing orders per day) on dates impacted by each effect. The inferred parameters suggest...methods for fundamental scientific discovery and high-impact applications.       Alvin Hsu is a graduate student...next-generation therapeutics. Prime editing, base editing, PACE, and DNA-templated synthesis are four examples of...
  7. Caltech Systemic Capsids

    Type
    Collection
    ... Viral Vector Packaging Service AAV Caltech Systemic Capsids Viral Vector Packaging Service: Caltech...CAP-B22 AAV9-X1.1 As part of our Viral Vector Packaging Service , Addgene is distributing ready-to-use...window) Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...
  8. Zinc Finger Consortium: Nuclease Expression Vectors

    Type
    Collection
    ...for expression of a ZFN targeted to a site with a spacer of 7 bps and harboring a “+” heterodimeric FokI...for expression of a ZFN targeted to a site with a spacer of 7 bps and harboring a “-” heterodimeric FokI...expression of a ZFN targeted to a site with a 5 or 6 bp spacer and “+” KKR heterodimeric FokI domain. ( Doyon ...expression of a ZFN targeted to a site with a 5 or 6 bp spacer and “-” ELD heterodimeric FokI domain. ( Doyon ...
  9. Kit Free RNA Extraction

    Type
    Protocol
    ...hazards for these reagents. Work in a well-ventilated space and under a fume hood when working with the volatile...
  10. Viral Genome Sequencing - A One Stop Shop for AAV Identity and Serotype Confirmation

    Type
    Blog Post
    ...amount of spurious DNA from the packaging cell line, helper and packaging plasmids. We decided to use this... genome exists as [+] and [-] strands that are packaged at the same frequency, we reasoned that, following...viral genome sequencing to determine serotype AAV packaging is not perfect and while we think of the AAV vector...not require any additional reagents or lab work (Pacouret, 2017). Moreover, the sequencing data from multiple...Method for Rapid and Inexpensive Validation of Packaged Single-Stranded Adeno-Associated Viral Genomes...195–205 . https://doi.org/10.1089/hgtb.2019.110 Pacouret S, Bouzelha M, Shelke R, Andres-Mateos E, Xiao...
  11. Serotype Testing AAV

    Type
    Collection
    ... Viral Vector Packaging Service AAV Serotype Testing AAV Viral Vector Packaging Service: Serotype ...order it? Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...
  12. CRISPR 101: Cytosine and Adenine Base Editors

    Type
    Blog Post
    ..., ABE8s resulted in 1.5-fold more editing at protospacer positions A5-A7 and 3.2-fold more editing at ...to ABE7.10. ABE8s have an improved base editing capacity, even at sites previously difficult to target....Joung’s lab created a dual-deaminase editor called SPACE (synchronous programmable adenine and cytosine editor...and adenine base editors Grünewald et al., 2020 SPACE   Fused cytosine and adenine base editors Walton...01532-7 Gaudelli, N. M., Komor, A. C., Rees, H. A., Packer, M. S., Badran, A. H., Bryson, D. I., & Liu, D.... J. M., Lee, S.-J., Liquori, A. J., Murray, R., Packer, M. S., Rinaldi, C., Slaymaker, I. M., Yen, J.,...020-0535-y Kim, Y. B., Komor, A. C., Levy, J. M., Packer, M. S., Zhao, K. T., & Liu, D. R. (2017). Increasing...
  13. Recombinases AAV Preps

    Type
    Collection
    ... Viral Vector Packaging Service AAV Recombinases Viral Vector Packaging Service: Recombinases ... Page . Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...
  14. AAV Molecular Tools

    Type
    Collection
    ... Viral Vector Packaging Service AAV Molecular Tools Viral Vector Packaging Service: Molecular Tools...6 Zhang Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...
  15. Important Considerations When Using AAVs

    Type
    Blog Post
    ...Richard J. Samulski. "Packaging capacity of adeno-associated virus serotypes: impact of larger genomes on...cells of interest. Although they have a small packaging capacity, AAV vectors were suitable for our needs ...recombinant adeno-associated viral vectors: packaging capacity and the role of rep proteins in vector purity...bleach solution should be used to clean AAVs from workspaces. Speed: AAV transduction experiments are ...
  16. Viral Vectors 101: An Introduction to AAV

    Type
    Blog Post
    ...AAV components      Cargo capacity Empty rAAV has a cargo capacity of ~ 4.7 kb, meaning that your... is a single stranded, Parvoviridae DNA virus, packaged in a non-enveloped icosahedral capsid, that can...in recombinant AAVs (rAAVs) with maximum “trunk” space for genetic cargo. Typically, when researchers speak...the type of capsid (outer protein shell) used to package an rAAV vector; these capsids allow the virus to...design single rAAV vectors with multiple genes packaged in them and use elements such as IRES or 2A to...rescued from the vector plasmid and individually packaged into the AAV capsids. As a genome conversion in...
  17. AAV for Neuronal Tracing

    Type
    Collection
    ... Viral Vector Packaging Service AAV Monosynaptic Neuronal Tracing Viral Vector Packaging Service: Tools...17329205 Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...
  18. Chemogenetics AAV Preps

    Type
    Collection
    ... Viral Vector Packaging Service AAV Chemogenetics Viral Vector Packaging Service: Chemogenetics...Chemogenetics AAV Don’t See What You’re Looking For? Our Packaged on Request service offers you even more options...Please note this does not guarantee viral vector packaging service, but lets us know what viruses would be...
  19. #DeckTheLab with Tinsel and Test Tubes, Fa La La La La La La La La

    Type
    Blog Post
    ...simply embellish and adorn your lab space or your work from home space in a fun, festive holiday or winter...selected as a winner, you’ll receive a winter care package from Addgene.  Here are the details:   Contest...winter or holiday theme decor in your work from home space… but with a science twist. Maybe you have a collection...using life science catalog pages. Make your WFH space feel a little more festive this holiday season! ...Instagram as we share pictures of our decked out spaces.       ...
Showing: 81 - 100 of 562 results