Skip to main content
Addgene

We narrowed to 91 results for: aav gfp cre

Showing: 81 - 91 of 91 results
  1. Hot Plasmids and Viral Preps - July 2021

    Type
    Blog Post
    ...of GCaMP8 AAV preps has expanded. Check out the new selection of ready-to-use AAV9 and AAVrg vectors. ...available in AAV8! Expand your imaging experiments with the Cre-OFF/FLP-ON vector 137128-AAV8: Ef1a-Coff...circularly permuted green fluorescent protein or cpGFP) to the petunia SL enzymatic receptor DAD2. SLs ...which modulates the fluorescence intensity of the cpGFP without altering that of the internal control (Fig...of biosensors could be used in high throughput screening for agrochemical compounds that have the potential...
  2. Hot Plasmids - October 2022

    Type
    Blog Post
    ... are currently available as Cre-dependent, EF1ɑ-driven viral vectors (AAV1) - and you can also find several...Addgene’s western blot for the myc-tagged protein GFP-smFP-myc expressed from Plasmid 98926. See the Applications...called JEDI-2P. Using a custom, high-throughput screening platform to apply saturating mutagenesis on 21... 1: Summary of the approach and outcomes of the screen for improved genetically-encoded voltage indicators... in-vivo imaging of voltage fluctuations. Image credit: Liu Z, et al. Cell. 2022.  Find JEDI-2p viral... Anti-c-Myc [9E10] page for more details. Image credit: Addgene.   Find anti-c-Myc antibody here! ...
  3. CRISPR Plasmids - Tagging

    Type
    Collection
    ...include Cre and FLP expression vectors, a general cloning plasmid, and a prebuilt Unc-32::GFP targeting...provide PCR templates for amplification of the tag (eg GFP, Flag, YFP, etc) and selection markers. Two independent..._CEBPA_1 PX458_CEBPA_2 CREB1 Human FLAG pFETCh_CREB1 PX458_CREB_1 PX458_CREB_2 TGIF2 Human FLAG pFETCh_TGIF2...targeting the AAVS1 locus. Doyon Tagging Plasmid: 3xFLAG-2xSTREP Construct for integrating at the AAVS1 "safe ... lines were created using CRISPR and the donor plasmids containing homology arms and EGFP are available...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs...cloned directly into this vector and targeted to the AAVS1 genomic safe harbor locus using untagged SpCas9 ...
  4. Validated gRNA Sequences

    Type
    Collection
    ...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes...GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes 24825012 Sibley GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA...Otonkoski AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 58252 cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens...23287722 Church AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 50662 cut S. pyogenes 24336569 Sabatini AAVS1 H. sapiens...
  5. Adenoviral Delivery of CRISPR/Cas9 Aims to Expand Genome Editing to Primary Cells

    Type
    Blog Post
    ...AdVs have already a packaging capacity larger than AAV vectors. This capacity is large enough to carry the... pAdSh.PGK.Cas9, pAdSh.U6.gRNAS1, and pAdSh.U6.gRNAGFP. Gonçalves says that advantages of AdVs include...templates in somatic cells of adult animals in order to create animal models for particular cancer. That’s exactly...the Memorial Sloan Kettering Cancer Center did to create a model of Eml4–Alk-driven lung cancer (Maddalo... Addgene and could be useful to labs wishing to create this kind of animal models. Start using adenoviral...guide RNA constructs, pAdSh.U6.gRNAS1 and pAdSh.U6.gRNAGFP, and also Adeno Cas9 and Adeno EA. Or if you're...Circ Res 115:488–492 . https://doi.org/10.1161/circresaha.115.304351 Holkers M, Maggio I, Henriques SFD...
  6. Minigenomes - a Safe Way to Study Dangerous Viruses Like the Ebola Virus

    Type
    Blog Post
    ...Plasmids Read Our Lentiviral Vector Guide Read Our AAV Guide  ...This post was contributed by guest blogger Tessa Cressey. The highly pathogenic Ebola virus belongs to the...non-viral) reporter gene (e.g. firefly luciferase or eGFP) flanked by the EBOV-specific gene start and gene...various viral components play in disease. Tessa Cressey is a PhD Student in the labs of Dr. Elke Mühlberger...
  7. Molecular Biology Reference

    Type
    Guide
    ...use these plasmids to create viral particles, such as lentiviral, retroviral, AAV, or adenoviral particles...contain a reporter gene (for example, luciferase or GFP) that offers a read-out of the activity of the genetic...expanding viral service offers select ready-made AAV and lentiviral particles. Visit our viral service...study DNA fragments of interest, such as genes. Creation of recombinant DNA Molecular Cloning Plasmids ... With current cloning technology, it is easy to create and modify plasmids containing the genetic element...vector can also include an enhancer sequence which increases the amount of protein or RNA produced. Expression...used in place of ampicillin. Preparing Antibiotics Create a stock solution of your antibiotic. Unless otherwise...
  8. How to Deposit Your Plasmids with Addgene

    Type
    Blog Post
    ...in bacteria) such as lentiviral, retroviral, and AAV plasmids, we recommend the NEB Stable strain. For...process. To deposit plasmids online, you will need to create an account with Addgene before starting the process...plasmids, and adding all the plasmids at once increases the likelihood that the plasmids are given sequential...Please describe any tags or fusions (e.g. His, FLAG, EGFP, etc) on your insert. Use the drop-down menu to ...
  9. CRISPR Guide

    Type
    Guide
    .... Mammalian CRISPR libraries have also been created in AAV backbones for in vivo experiments and in a ...fluorescent marker like green fluorescent protein (GFP), creating a customizable DNA or RNA label for fluorescence...efficiently packaged into adeno-associated viruses (AAVs) . Other natural Cas orthologs include Hsp1Cas9 ...used for large scale edits. These proteins, like Cre recombinase or phage derived serine integrases, insert...capabilities but are small enough to be packaged in AAV particles. Cas13 fusions have also been used in in... GAT; increase nuclease fidelity SpCas9-NG - NG; increase in vitro activity SpG - NGN; increase nuclease...others work to increase Cas9’s proofreading capabilities. No matter the method, increased fidelity enzymes...
  10. CRISPR Guide

    Type
    Collection
    .... Mammalian CRISPR libraries have also been created in AAV backbones for in vivo experiments and in a ...fluorescent marker like green fluorescent protein (GFP), creating a customizable DNA or RNA label for fluorescence...efficiently packaged into adeno-associated viruses (AAVs) . Other natural Cas orthologs include Hsp1Cas9 ...used for large scale edits. These proteins, like Cre recombinase or phage derived serine integrases, insert...capabilities but are small enough to be packaged in AAV particles. Cas13 fusions have also been used in in... GAT; increase nuclease fidelity SpCas9-NG - NG; increase in vitro activity SpG - NGN; increase nuclease...others work to increase Cas9’s proofreading capabilities. No matter the method, increased fidelity enzymes...
  11. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...envelope 114404 AAVS1-mEGFP (PGK) AICSDP-36 mEGFP NA Cytoplasm 114405 ATP2A2-mEGFP AICSDP-41 mEGFP SERCA2 Sarcoplasmic...Structure 87420 PXN-EGFP AICSDP-1 EGFP Paxillin Matrix Adhesions 87421 TUBA1B-mEGFP AICSDP-4 mEGFP Alpha-tubulin...87422 LMNB1-mEGFP AICSDP-10 mEGFP Lamin B1 Nuclear envelope 87423 TOMM20-mEGFP AICSDP-8 mEGFP Tom20 Mitochondria...Mitochondria 87424 DSP-mEGFP AICSDP-9 mEGFP Desmoplakin Desmosomes 87425 ACTB-mEGFP AICSDP-15 mEGFP Beta-actin Actin... SEC61B-mEGFP AICSDP-7 mEGFP Sec61 beta Endoplasmic reticulum 87427 FBL-mEGFP AICSDP-13 mEGFP Fibrillarin...AICSDP-23 mEGFP Tight junction protein ZO-1 Tight junctions 91565 AAVS1-mEGFP AICSDP-35 mEGFP NA Cytoplasm...101782 LAMP1-mEGFP AICSDP-19 mEGFP LAMP-1 Lysosome 101783 MAP1LC3B-mEGFP AICSDP-25 mEGFP Autophagy-related...
Showing: 81 - 91 of 91 results