We narrowed to 94 results for: aav gfp cre
-
TypeBlog Post...both the GFP and the RFP proteins in the nucleus. During the first round of translation, the GFP proteins...Compartment mCherry-Rab5 BFP-Rab5 GFP-Rab5B Vacuolar & Budding Compartment GFP-Rab4B Mitochondria mito-BFP...GTPase in division) GFP-Mff (outer membrane protein) Late Endosome mCherry-Rab7A GFP-Rab7A ...protein Knock-off, is made up of three components: a GFP protein that binds to the coding region of a reporter...reporter mRNA via a PP7 coat protein (NLS-PCP-GFP) a RFP protein that binds to the 3’ UTR of the reporter...these dCas9s with one of three fluorescent proteins (GFP, BFP and mCherry), the authors were able to visualize...monoclonal antibodies against them, fused them to GFP, and compared them to popularly used epitopes tags...
-
Neurodegeneration Plasmid Collection
TypeCollection... PINK1 N-GFP PINK1 GFP CMV Parkinson's Mark Cookson 13316 pcDNA-DEST47 PINK1 C-GFP PINK1 GFP CMV Parkinson's...21190 GFP-pcDNA3-PKCgamma-cys1Acys1B PRKCG GFP CMV Spinocerebellar ataxia 27 Tobias Meyer 21204 GFP-N2-PKCgamma...PKCgamma PRKCG GFP CMV Spinocerebellar ataxia 26 Tobias Meyer 21205 GFP-C1-PKCgamma-C1A PRKCG GFP CMV Spinocerebellar...-HtrA2-EGFP HTRA2 GFP CMV Parkinson's L. Miguel Martins 14122 pcDNA3-HtrA2-EGFP S306A HTRA2 GFP CMV Parkinson's... GPD 25QDProGFP p416 HTT GFP GPD Huntington's Susan Lindquist 15569 GPD 104QDProGFP p416 HTT GFP GPD Huntington's...GAL 25Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15581 GAL 46Q+ProGFPp416 HTT GFP GAL1 Huntington's...GAL 72Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15583 GAL 103Q+ProGFPp416 HTT GFP GAL1 Huntington's... -
Hot Plasmids and Viral Preps - July 2021
TypeBlog Post...of GCaMP8 AAV preps has expanded. Check out the new selection of ready-to-use AAV9 and AAVrg vectors. ...available in AAV8! Expand your imaging experiments with the Cre-OFF/FLP-ON vector 137128-AAV8: Ef1a-Coff...circularly permuted green fluorescent protein or cpGFP) to the petunia SL enzymatic receptor DAD2. SLs ...which modulates the fluorescence intensity of the cpGFP without altering that of the internal control (Fig...of biosensors could be used in high throughput screening for agrochemical compounds that have the potential... -
Hot Plasmids - October 2022
TypeBlog Post... are currently available as Cre-dependent, EF1ɑ-driven viral vectors (AAV1) - and you can also find several...Addgene’s western blot for the myc-tagged protein GFP-smFP-myc expressed from Plasmid 98926. See the Applications...called JEDI-2P. Using a custom, high-throughput screening platform to apply saturating mutagenesis on 21... 1: Summary of the approach and outcomes of the screen for improved genetically-encoded voltage indicators... in-vivo imaging of voltage fluctuations. Image credit: Liu Z, et al. Cell. 2022. Find JEDI-2p viral... Anti-c-Myc [9E10] page for more details. Image credit: Addgene. Find anti-c-Myc antibody here! ... -
Genetic Code Expansion
TypeCollection...first with a control reporter gene – GFP for E. coli or mCherry-GFP for mammalian cells. You should also...pIDTsmart-MbPylRS-4xPyOtR-ITR-GFP PylRS M. barkeri Azidolysine (AzK) Mammalian, AAV TAG Abhishek Chatterjee ...Mammalian TAG Peter Schultz 50831 pAcBac2.tR4-OMeYRS/GFP* tyrosyl-tRNA synthetase E. coli various unnatural...or DiZHSeC Mammalian TAG P. Chen 92047 pCOTS-pyl-GFP(35TAG) PylRS M. mazei Cyanobacterial TAG Lital Alfonta...analogs Mammalian TAG Huiwang Ai 160041 pRaGE Pyl TAG GFP Y35TAG PylRS M. mazei Bacterial TAG Lital Alfonta...C321.Ub-UAG-sfGFP all TAG sites changes to UAG, RF1 function removed, with Ubiquitin-UAG-sfGFP reporter ...M. barkeri , or E.coli and can be mutated and screened through directed evolution to charge the tRNA ... -
Validated gRNA Sequences
TypeCollection...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes...GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes 24825012 Sibley GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA...Otonkoski AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 58252 cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens...23287722 Church AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 50662 cut S. pyogenes 24336569 Sabatini AAVS1 H. sapiens... -
CRISPR Plasmids - Tagging
TypeCollection...include Cre and FLP expression vectors, a general cloning plasmid, and a prebuilt Unc-32::GFP targeting...provide PCR templates for amplification of the tag (eg GFP, Flag, YFP, etc) and selection markers. Two independent..._CEBPA_1 PX458_CEBPA_2 CREB1 Human FLAG pFETCh_CREB1 PX458_CREB_1 PX458_CREB_2 TGIF2 Human FLAG pFETCh_TGIF2...targeting the AAVS1 locus. Doyon Tagging Plasmid: 3xFLAG-2xSTREP Construct for integrating at the AAVS1 "safe ... lines were created using CRISPR and the donor plasmids containing homology arms and EGFP are available...Other Applications Purify Tag Visualize dCas9-FokI Screen Pooled Libraries gRNAs Empty gRNA Vectors gRNAs...cloned directly into this vector and targeted to the AAVS1 genomic safe harbor locus using untagged SpCas9 ... -
Adenoviral Delivery of CRISPR/Cas9 Aims to Expand Genome Editing to Primary Cells
TypeBlog Post...AdVs have already a packaging capacity larger than AAV vectors. This capacity is large enough to carry the... pAdSh.PGK.Cas9, pAdSh.U6.gRNAS1, and pAdSh.U6.gRNAGFP. Gonçalves says that advantages of AdVs include...templates in somatic cells of adult animals in order to create animal models for particular cancer. That’s exactly...the Memorial Sloan Kettering Cancer Center did to create a model of Eml4–Alk-driven lung cancer (Maddalo... Addgene and could be useful to labs wishing to create this kind of animal models. Start using adenoviral...guide RNA constructs, pAdSh.U6.gRNAS1 and pAdSh.U6.gRNAGFP, and also Adeno Cas9 and Adeno EA. Or if you're...Circ Res 115:488–492 . https://doi.org/10.1161/circresaha.115.304351 Holkers M, Maggio I, Henriques SFD... -
Minigenomes - a Safe Way to Study Dangerous Viruses Like the Ebola Virus
TypeBlog Post...Plasmids Read Our Lentiviral Vector Guide Read Our AAV Guide ...This post was contributed by guest blogger Tessa Cressey. The highly pathogenic Ebola virus belongs to the...non-viral) reporter gene (e.g. firefly luciferase or eGFP) flanked by the EBOV-specific gene start and gene...various viral components play in disease. Tessa Cressey is a PhD Student in the labs of Dr. Elke Mühlberger... -
Molecular Biology Reference
TypeGuide...use these plasmids to create viral particles, such as lentiviral, retroviral, AAV, or adenoviral particles...contain a reporter gene (for example, luciferase or GFP) that offers a read-out of the activity of the genetic...expanding viral service offers select ready-made AAV and lentiviral particles. Visit our viral service...study DNA fragments of interest, such as genes. Creation of recombinant DNA Molecular Cloning Plasmids ... With current cloning technology, it is easy to create and modify plasmids containing the genetic element...vector can also include an enhancer sequence which increases the amount of protein or RNA produced. Expression...used in place of ampicillin. Preparing Antibiotics Create a stock solution of your antibiotic. Unless otherwise... -
How to Deposit Your Plasmids with Addgene
TypeBlog Post...in bacteria) such as lentiviral, retroviral, and AAV plasmids, we recommend the NEB Stable strain. For...process. To deposit plasmids online, you will need to create an account with Addgene before starting the process...plasmids, and adding all the plasmids at once increases the likelihood that the plasmids are given sequential...Please describe any tags or fusions (e.g. His, FLAG, EGFP, etc) on your insert. Use the drop-down menu to ... -
CRISPR Guide
TypeGuide.... Mammalian CRISPR libraries have also been created in AAV backbones for in vivo experiments and in a ...fluorescent marker like green fluorescent protein (GFP), creating a customizable DNA or RNA label for fluorescence...efficiently packaged into adeno-associated viruses (AAVs) . Other natural Cas orthologs include Hsp1Cas9 ...used for large scale edits. These proteins, like Cre recombinase or phage derived serine integrases, insert...capabilities but are small enough to be packaged in AAV particles. Cas13 fusions have also been used in in... GAT; increase nuclease fidelity SpCas9-NG - NG; increase in vitro activity SpG - NGN; increase nuclease...others work to increase Cas9’s proofreading capabilities. No matter the method, increased fidelity enzymes... -
CRISPR Guide
TypeCollection.... Mammalian CRISPR libraries have also been created in AAV backbones for in vivo experiments and in a ...fluorescent marker like green fluorescent protein (GFP), creating a customizable DNA or RNA label for fluorescence...efficiently packaged into adeno-associated viruses (AAVs) . Other natural Cas orthologs include Hsp1Cas9 ...used for large scale edits. These proteins, like Cre recombinase or phage derived serine integrases, insert...capabilities but are small enough to be packaged in AAV particles. Cas13 fusions have also been used in in... GAT; increase nuclease fidelity SpCas9-NG - NG; increase in vitro activity SpG - NGN; increase nuclease...others work to increase Cas9’s proofreading capabilities. No matter the method, increased fidelity enzymes... -
Allen Institute for Cell Science Plasmid Collection
TypeCollection...envelope 114404 AAVS1-mEGFP (PGK) AICSDP-36 mEGFP NA Cytoplasm 114405 ATP2A2-mEGFP AICSDP-41 mEGFP SERCA2 Sarcoplasmic...Structure 87420 PXN-EGFP AICSDP-1 EGFP Paxillin Matrix Adhesions 87421 TUBA1B-mEGFP AICSDP-4 mEGFP Alpha-tubulin...87422 LMNB1-mEGFP AICSDP-10 mEGFP Lamin B1 Nuclear envelope 87423 TOMM20-mEGFP AICSDP-8 mEGFP Tom20 Mitochondria...Mitochondria 87424 DSP-mEGFP AICSDP-9 mEGFP Desmoplakin Desmosomes 87425 ACTB-mEGFP AICSDP-15 mEGFP Beta-actin Actin... SEC61B-mEGFP AICSDP-7 mEGFP Sec61 beta Endoplasmic reticulum 87427 FBL-mEGFP AICSDP-13 mEGFP Fibrillarin...AICSDP-23 mEGFP Tight junction protein ZO-1 Tight junctions 91565 AAVS1-mEGFP AICSDP-35 mEGFP NA Cytoplasm...101782 LAMP1-mEGFP AICSDP-19 mEGFP LAMP-1 Lysosome 101783 MAP1LC3B-mEGFP AICSDP-25 mEGFP Autophagy-related...