Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 165 results for: control GFP

Showing: 81 - 100 of 165 results

  1. Antibodies 101: Immunoprecipitation

    Type
    Blog Post
    ...protein. With this control set, you should see your target protein IP’d in the positive control sample but not...permanently altering the structure of the protein.  Controls As with any experiment, it is critical to include...include proper positive and negative controls for an IP. When possible, perform the IP in parallel with ...interest and a sample that does not. Common negative controls include knockout cell lines or tissues that do... not in the negative control, confirming that the capture antibody is functioning as expected. In order...perform parallel IPs with beads only and an isotype control antibody. Alternative applications Oftentimes, ...In cases such as this, an epitope such as c-Myc, GFP or V5 can be used to tag the protein of interest ...

  2. Antibodies 101: Introduction to Antibodies

    Type
    Blog Post
    ...blot showing GFP expression in cells that have been transfected with a plasmid encoding GFP. Actin, a common...detection. You’ll also want to use the appropriate controls for your experiment to account for potential non-specific...quantitatively if you also load the gel with appropriate controls for normalizing the protein concentration. To ... common internal control for Western blots, shows that a similar concentration of cell lysate was added...

  3. Optogenetics AAV Preps

    Type
    Collection
    ...soCoChR-GFP Syn CoChR (soma-targeted) GFP Constitutive 9 Boyden 107712 pAAV-hSynapsin-FLEX-soCoChR-GFP Syn...pAAV-hsyn-Jaws-KGC-GFP-ER2 Syn Jaws GFP Constitutive 5, 8, rg* Boyden 84445 pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] CAG...* Deisseroth 58880 pAAV-Syn-ChR2(H134R)-GFP Syn ChR2/H134R GFP Constitutive 8, rg* Boyden 100054 pAAV....Constitutive 9 Harvey 59170 pAAV-Syn-Chronos-GFP Syn Chronos GFP Constitutive 1, 5, rg* Boyden 59171 pAAV-...Constitutive 8 Deisseroth 22222 AAV-FLEX-Arch-GFP CAG Arch GFP Cre dependent 1, 9 Boyden 28305 pAAV-FLEX-...dependent 5 Boyden 99039 pAAV-CamKII-ArchT-GFP (PV2527) CaMKII ArchT GFP Constitutive 1, 5, 9, rg* Boyden 137148...Optogenetics AAV Optogenetic tools can be used to control cell activity in living tissue with light. Optogenetics...

  5. Multiple Plasmids at a Low Price: Kits from Addgene

    Type
    Blog Post
    ...various combinations of protein tags (His, Avi, and GFP) as well as protease sites to facilitate protein ...’ end of the leader sequence. Using a variety of GFP and RFP fusions as their test genes, the researchers...terminators of varying strengths centered within GFP/RFP bicistronic reporters characterized in Cambray... Living Bacteria Using an Orthogonal Ribosome-Controlled Fluorescent Reporter."ACS chemical biology 11.1...et al 2015). He has also constructed a library of eGFP-tagged human ORF clones to allow testing and comparison...be conveniently performed through the N-terminal eGFP tag carried on all constructs. The Cell-Free Protein...

  6. Antibody Production

    Type
    Collection
    ... undergo stringent quality control by Addgene or a trusted quality control partner before distribution...Addgene's antibody production methods and quality control processes for purified recombinant antibodies. ...production protocols, titering methods, and quality control are described below. Information for a specific...samples with >90% purity are distributed. Quality Control Each lot of antibody undergoes testing, either ... not endogenously-expressed (e.g., using an anti-GFP antibody), the target antigen is first transiently...fluorescence pattern is compared to an untransfected control. Immunohistochemistry (IHC) Tissue sections are...Protein expression is compared to an untransfected control and the protein size is confirmed. Residual Plasmid...

  7. Fluorescent Proteins 101: Fluorescent Protein Timers

    Type
    Blog Post
    ...placing FP timer DsRed-E5 under the control of Neurog3 (a gene controlling pancreatic differentiation) in ...synthesized or long-lived transcription factors control gross changes in gene expression as new body sections...Pratik, et al. "A programmable synthetic lineage-control network that differentiates human IPSCs into glucose-sensitive...Fluorescent Protein Aggregation Catch Up On Your GFP Basics Get Advice on Choosing Your Fluorescent Protein...

  8. Plasmids 101: The Promoter Region – Let's Go!

    Type
    Blog Post
    ...target genes. The sequence of the promoter region controls the binding of the RNA polymerase and transcription... all the time while others are more carefully controlled. Regulated promoters might act only in certain... light. In the cell, promoters themselves are controlled by still other regulatory factors: enhancers,...induced. Requires T7 RNA polymerase, which is also controlled by lac operator. Can be induced by IPTG. Commonly...Vectors Read about Reporter Gene like Luciferase and GFP Resources on Addgene.org Find Plasmids for Your...

  9. AAV Molecular Tools

    Type
    Collection
    ... These AAV encode tetracycline-inducible tools/controls and tetracycline transactivators that can be used...Cre-dependent Cre-dependent expression of membrane-bound GFP and synaptophysin-mRuby for labeling of axon terminals...System Activity Serotype PI 124364 pAAV-FLEX-DTR-GFP CBA-driven, Cre-dependent Cre-dependent expression...expression of diphtheria toxin receptor fused to GFP for studying cell ablation. 2 Jessell , Azim 45580 pAAV-... Serotype PI 98747 pAAV-FLEX-EGFPL10a EF1a-driven and Cre-dependent EGFP-tagged ribosomal L10a 5, rg* ...and synaptophysin-EGFP for labeling of axon terminals. 1 Zeng 71760 pAAV hSyn FLEx mGFP-2A-Synaptophysin-mRuby...Serotype PI 51509 AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE Syn-driven, Cre-dependent Cre-dependent expression...

  10. Luciferase Plasmid Collection

    Type
    Collection
    ...Root 105533 pAAV.CMV.Luc.IRES.EGFP.SV40 Firefly CMV AAV expression of firefly luciferase and GFP James Wilson...pKC-4.06 : Nonsense-mediated decay reporter and control plasmid utilizing Firefly luciferase. Transcriptional...luciferase gene fusions. Renilla luciferase under the control of a CMV promoter is present for normalization ...Vector Firefly Vector for investigating regions controlling transcription Debrya Groskreutz 60323 pGL4.23...fusions in plants. Renilla luciferase under the control of a CMV promoter is present for normalization ...luciferase. Firefly luciferase expression under the control of a HSV TK promoter for normalization Ting Ni ...luciferase. Firefly luciferase expression under the control of a HSV TK promoter for normalization. Modified...

  11. Light Sheet Fluorescence Microscopy

    Type
    Blog Post
    ...mouse brains expressing green fluorescent protein (GFP) (6).   The Dodt and Frank Bradke laboratories later...subpopulation of neurons are brightly labeled with GFP (e.g. Thy1-YFP-H mice).  However, we recently developed...use of viruses allows much better spatiotemporal control over labeling methods as compared to transgenic... nerve afferents labelled with a AAV8 expressing eGFP under the human ubiquitin C promoter. Anatomical...

  12. pSiM24: Simplifying Plant Genetic Engineering

    Type
    Blog Post
    ...Arabidopsis, and corn. For both β-glucuronidase (GUS) and GFP reporters, as well as multiple transient and transgenic.... The kanamycin antibiotic resistance gene is controlled by a weaker constitutive Nos promoter, and it...

  13. Plasmids 101: Repressible Promoters

    Type
    Blog Post
    ...from the Church lab uses this system to control expression of GFP.)  To turn this inducible system into ...Promoters control the binding of RNA polymerase and transcription factors. Since the promoter region ...promoters can be regulated via positive or negative control. Positive Repressible: An activator protein is ...system, Gossen and Bujard created the tetracycline-controlled transactivator (tTA). They fused TetR with the...interest to be expressed. These permit exquisite control of gene expression and tracing of gene expression...that sometimes it is necessary or desirable to control or look at multiple genes at the same time.  The... genetic analysis in Drosophila or for precise control over multiple genes in synthetic systems. Recent...

  15. Quick Guide to All Things Lentivirus

    Type
    Blog Post
    ...containing the gene of interest (pTet-IRES-EGFP, pPRIME-Tet-GFP-FF3) and one with either tTA or rtTA (FUW-M2rtTA...your gene and the marker can be placed under the control of two different promoters. Both the single and...derivative such as Doxycycline (Dox), the Tet-controlled transactivator (tTA, also expressed by your transfer...viral titre to the number of cells transduced by a GFP encoded virus, and the reverse transcriptase activity...

  16. Tetracycline Inducible Expression

    Type
    Collection
    ...Eric Kowarz 96930 XLone-GFP Tet-On PiggyBac vector for inducble expression of EGFP Tet-On 3G rtTA TRE3GS...171123 pLVX-TetOne-Puro-GFP Lentiviral Tet-On vector for inducible expression of EGFP Tet-On 3G rtTA TRE3GS... for Tet-controlled expression (On or Off) None Tight TRE Markus Ralser 64238 pTet-IRES-EGFP Lentiviral...Lentiviral plasmid for Tet-controlled expression of transgene of interest with EGFP (On or Off) None TRE, miniCMV...and repressible promoters are powerful tools to control gene expression and study biological targets. The...popular choices for rapid, efficient, and reversible control of gene expression in eukaryotes. To avoid secondary... While TetR and tet O could be a basic tool to control gene expression, the system has been engineered...

  17. Validated gRNA Sequences

    Type
    Collection
    ...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...negative control CTGGAATGAATTGGCCTATG 68893 interfere S. pyogenes 26918244 Lu negative control M. musculus...negative control synthetic GTCAAGGCACTCTTGCCTA 64955 cut S. pyogenes 25527740 Bleris negative control H. sapiens...GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes...66895 cut S. pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut ...

  18. Viral Vectors 101: Virus Safety

    Type
    Blog Post
    ...virus and its infectivity in check. Engineering controls, safety systems that are built into how something...functions, were designed for this purpose. One such control is dividing up the essential components of a virus... for a researcher to come into contact with than GFP. Similarly, if the viral vector carries an shRNA ...

  19. Tips for Screening with Yeast Two Hybrid Systems

    Type
    Blog Post
    ...in this case a reporter gene (e.g. luciferase or GFP), regardless of whether it interacts with a transcriptional...accounted for using appropriate replicates and controls (see Tips below), and by validating leads with...reporter gene activation. Including a prey-only control also provides a baseline level of reporter activation...that are known to bind serves as a good positive control to ensure that your setup works. The last thing...

  20. Antibodies 101: Affinity Tags

    Type
    Blog Post
    ...You’ve designed the perfect experiment – controls, conditions, and everything in between – now all you... (FLAG, Myc, etc.) and fluorescent protein tags (GFP, mCherry, etc.). Fluorescent tags are primarily used...
Showing: 81 - 100 of 165 results