Skip to main content

We narrowed to 93 results for: cre recombinase

Showing: 81 - 93 of 93 results
  1. CRISPR References and Information

    Type
    Collection
    ... (pharyngeal co-injection marker); pDD104 (Cre recombinase) PDF, 105 KB Jaenisch CRISPR plasmid summary...- a CRISPR Screen Tool (Link opens in a new window) Design gRNAs for custom CRISPR screens targeting a...in your lab, from knockouts to pooled library screening. CRISPR eBook Addgene's downloadable eBook about...CRISPR pooled libraries for large-scale functional screens. Available for knockout, activation, inhibition...For use with genome-scale CRISPR-Cas9 knockout screens (or GeCKO) technology. Developed by the Xiaole ...batch (Link opens in a new window) for lentiviral screens. sgRNA Scorer 2.0 (Link opens in a new window) ...considerations, and more. CasPEDIA is a community resource created and maintained by the Jennifer Doudna Lab . Read...
  2. Viral Vectors 101: AAV Variables That Matter

    Type
    Blog Post
    ...and/or off-target effects (e.g. recombinase-dependent vectors) increases with the amount of virus you add...from Aschauer et al., 2013, Figure 1. Used under Creative Commons Attribution License. Within the nervous...can become methylated over time, resulting in decreased expression (Damdindorj et al., 2014; Nieuwenhuis...from Griffin et al., 2019, Figure 4. Used under Creative Commons Attribution 4.0 International License....vice versa. The total volume needed, however, increases with the size of the region you want to cover ...
  3. Delivery Methods for Generating iPSCs

    Type
    Blog Post
    ...lentiviral vector, but transient expression of Cre recombinase allows for deletion of the inserted transgenes...formation in iPSC-derived and iPSC-transplanted mice. Cre-deletable or Tet-inducible lentiviruses address some...considered safe for clinical applications. Excisable Cre-lox lentiviral vectors: This approach is the same...insertional mutagenesis. Random integration also creates heterogeneous iPSC cell lines, which can complicate...insertional mutagenesis and random integration creates variation between iPSC clones. Retroviruses are...which is removed by culturing cells at 38℃, but screening cells for the presence of transgenes is still ...
  4. Plasmids 101: Modular Cloning Applications and Kits

    Type
    Blog Post
    ...specialized system with parts including site-specific recombinases, regulatory elements, developmental regulators... technology has been used to optimize protein secretion and expression in the biotech workhorse yeast ...Engineering disease resistance through gene stacking, increasing production of a protein of interest, and improving...genetic circuits with multiplexed guides, mini screening libraries, direct edit optimization, and more....can be invaluable for more complex editing and screening experiments in organisms that don’t yet have these...modify it as necessary. And remember, if you end up creating a really cool MoClo kit, we would love for you...Modular Toolkit for Generating Pichia Pastoris Secretion Libraries.” ACS Synthetic Biology, vol. 6, no....
  5. Deaminet 2026: Breakthroughs in Base Editing, Deaminase Biology, and Therapeutic Translation

    Type
    Blog Post
    ...double-stranded regions just long enough for recombinase binding, but too short to activate cGAS-sensing... The prime editor PE6d exhibits substantially increased processivity and editing efficiency relative to...release and heteroduplex resolution are not shown. Created with BioRender.com. PE6d, deposited by David... (Nicola Osgood, UC San Diego) enables pooled screening of hundreds of gRNA–base editor combinations in...alleles are caused by premature stop codons. By screening 18,000 pegRNAs across all 418 human tRNAs, they...Wallen (UPenn) showed APOBEC3B-driven mutagenesis increases dendritic cell infiltration in head and neck cancer...characterized editing outcomes are driving the need for increasingly precise, modality appropriate off-target assessment...
  6. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...loxP-stop-loxP cassette into the Rosa26 locus, allowing for Cre-dependent expression of a GMAP inserted gene. The...species. Indeed, in order to use MAGE, the λ Red recombinase enzymes need to be expressed and the native methyl-directed...plasmids (dubbed pORTMAGE) expresses the λ Red recombinase enzymes, as well as a dominant-negative mutator...of a good screening experiment can be found on our blog post entitled “Genome-wide Screening Using CRISPR...Receptor-ome Expression and Screening via Transcriptional Output-TANGO (PRESTO-TANGO) to screen the NCC-1 library...and later create stable cell lines expressing it. The Church lab fixed this issue by creating a new dCas9...  CRISPR pooled libraries enable researchers to screen the entire genome for genes that regulate a wide...
  7. Using AAV for Neuronal Tracing

    Type
    Blog Post
    ...often made Cre-dependent. If Cre-dependent vectors are used in transgenic animals that express Cre in only...conditional mutant mouse brain that expressed Cre recombinase only in pyramidal cells of the hippocampal ...labelling the subset of infected cells that also express Cre. Another advantage of AAV vectors is that there are... traced neurons with an AAV9 vector expressing a Cre-dependent fluorescent marker. Injection into a conditional...PMID: 4107258. Lo, L., and Anderson, D.J. (2011). A Cre-dependent, anterograde transsynaptic viral tracer...
  8. CRISPR Guide

    Type
    Guide
    ...Plasmids: CRISPR transposases CRISPR Recombinases and Integrases Recombinases, and their subfamily integrases...for large scale edits. These proteins, like Cre recombinase or phage derived serine integrases, insert ...mechanisms, including transposons, integrases, and recombinases, with Cas enzymes. CRISPR Transposases Transposon...lab , pairs prime editing with a large serine recombinase (LSR). A prime editor is used to install the ...evoBxb1 or eeBxb1 are evolved versions of the recombinase with improved integration efficiencies in mammalian...& Hsu, P. D. (2022). Systematic discovery of recombinases for efficient integration of large DNA sequences...GAT; increased nuclease fidelity SpCas9-NG — NG; increased in vitro activity SpG — NGN; increased nuclease...
  9. Optogenetics Guide

    Type
    Guide
    ...fragment of a protein of interest, such as Cre recombinase, is fused to Cry2 and the other fragment to...powerful when combined with site-specific recombinase systems like Cre-lox , which allows you to express an...using a viral vector with a floxed opsin in a VGAT-Cre animal will result in expression of the opsin only...Scherffelia dubia ). Synthetic variants have been created via genetic point mutations, codon optimization...Anion-conducting ChR variants that inhibit neurons have been created and identified in other species. By acting as light-gated...amplitude 490 ChR/T159C T159C mutation; displays increased photocurrents 470 SFO/SSFO Step Function Opsins...noctigama ; ChrimsonR carries K176R mutation with increased on/off kinetics 590 ChRmine Red-shifted channelrhodopsin...
  10. Sequencing Primers

    Type
    Guide
    ...immediate early promoter Forward CRE-R GCAAACGGACAGAAGCATTT 5' end of Cre recombinase Reverse CYC1 GCGTGAATGTAAGCGTGAC...
  11. Adenovirus Guide

    Type
    Guide
    ...adenoviral production, and is driven by use of the Cre recombinase. Genome Integration Upon infection, wild-type...contamination have been developed, such as using the Cre-lox and Flp-FRT recombination systems to excise the...Scientific Curation team at Addgene. Media Credits Figures created with BioRender (Link opens in a new window...Uses Safety Resources Plasmid Elements Glossary Credits Adenoviruses (AdV) are medium-sized, non-enveloped...adenoviruses have been modified by researchers to create recombinant adenoviral (rAdV) vectors in order ...with first-generation rAdV vectors and further increase the transgene packaging capacity up to ~10.5 kb...Vogelstein’s lab , is the most popular method for creating first-generation rAdV vectors, which is still ...
  12. Molecular Biology Reference

    Type
    Guide
    ...our CRISPR Guide . CRISPR Plasmids , Cre-lox and Other Recombinases , TALEN Plasmids and Kits , Genome ... into a right-handed, double-stranded helix. To create the double helix, the nucleotides on the opposing...fragments of interest, such as genes. Figure 1: Creation of recombinant DNA. Working with Plasmids Today... With current cloning technology, it is easy to create and modify plasmids containing the genetic element...vector can also include an enhancer sequence which increases the amount of protein or RNA produced. Expression...into target cells. You can use these plasmids to create viral particles (most commonly lentiviral, retroviral...method. Figure 3: Summary of Sanger sequencing. Created with BioRender.com. Next-generation Sequencing ...
  13. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...of sequence-specific enzymes (e.g. nucleases, recombinases) which irreversibly excise or invert a specific...upon these findings by screening for additional activation domains that increase the expression of target...Synchronization of secretory protein traffic in mammalian cells The journey of secretory proteins, from their... mutagenized and screened for speed and voltage sensitivity. This hierarchical screen led to the generation...has modified the RNA-guided CRISPR-Cas9 system to create a tool that is quick, versatile, and robust. Dubbed...adopt basic biological concepts and employ them in creative and innovative ways. The principle of protein ...molecule imaging and inducible gene expression by creating the SunTag system. The SunTag system, named after...
Showing: 81 - 93 of 93 results