We narrowed to 89 results for: cre recombinase
-
TypeBlog Post...lentiviral vector, but transient expression of Cre recombinase allows for deletion of the inserted transgenes...formation in iPSC-derived and iPSC-transplanted mice. Cre-deletable or Tet-inducible lentiviruses address some...considered safe for clinical applications. Excisable Cre-lox lentiviral vectors: This approach is the same...insertional mutagenesis. Random integration also creates heterogeneous iPSC cell lines, which can complicate...insertional mutagenesis and random integration creates variation between iPSC clones. Retroviruses are...which is removed by culturing cells at 38℃, but screening cells for the presence of transgenes is still ...
-
Plasmids 101: Modular Cloning Applications and Kits
TypeBlog Post...specialized system with parts including site-specific recombinases, regulatory elements, developmental regulators... technology has been used to optimize protein secretion and expression in the biotech workhorse yeast ...Engineering disease resistance through gene stacking, increasing production of a protein of interest, and improving...genetic circuits with multiplexed guides, mini screening libraries, direct edit optimization, and more....can be invaluable for more complex editing and screening experiments in organisms that don’t yet have these...modify it as necessary. And remember, if you end up creating a really cool MoClo kit, we would love for you...Modular Toolkit for Generating Pichia Pastoris Secretion Libraries.” ACS Synthetic Biology, vol. 6, no.... -
CRISPR Guide
TypeGuide...Plasmids: CRISPR transposases CRISPR Recombinases and Integrases Recombinases, and their subfamily integrases...for large scale edits. These proteins, like Cre recombinase or phage derived serine integrases, insert ...mechanisms, including transposons, integrases, and recombinases, with Cas enzymes. CRISPR Transposases Transposon...lab , pairs prime editing with a large serine recombinase (LSR). A prime editor is used to install the ...evoBxb1 or eeBxb1 are evolved versions of the recombinase with improved integration efficiencies in mammalian...& Hsu, P. D. (2022). Systematic discovery of recombinases for efficient integration of large DNA sequences... GAT; increase nuclease fidelity SpCas9-NG - NG; increase in vitro activity SpG - NGN; increase nuclease... -
27 Hot Plasmids from 2016
TypeBlog Post...loxP-stop-loxP cassette into the Rosa26 locus, allowing for Cre-dependent expression of a GMAP inserted gene. The...species. Indeed, in order to use MAGE, the λ Red recombinase enzymes need to be expressed and the native methyl-directed...plasmids (dubbed pORTMAGE) expresses the λ Red recombinase enzymes, as well as a dominant-negative mutator...of a good screening experiment can be found on our blog post entitled “Genome-wide Screening Using CRISPR...Receptor-ome Expression and Screening via Transcriptional Output-TANGO (PRESTO-TANGO) to screen the NCC-1 library...and later create stable cell lines expressing it. The Church lab fixed this issue by creating a new dCas9... CRISPR pooled libraries enable researchers to screen the entire genome for genes that regulate a wide... -
Optogenetics Guide
TypeGuide...powerful when combined with site specific recombinase technology like Cre-lox, which allows you to express an...when one half of a given protein, such as the Cre recombinase, is fused to Cry2 and the other half to CIB1...using a viral vector with a floxed opsin in a VGAT-cre animal will result in expression of the opsin only.... Novel recombinant adeno-associated viruses for Cre activated and inactivated transgene expression in... include: Increased photocurrent amplitude Examples: ChR2(H134R), C1V1(t/t), ChIEF Increased channel (... following enhancements: Increased light sensitivity Example: ArchT Increased photocurrent amplitude Examples...Scherffelia dubia ). Synthetic variants have been created via genetic point mutations, codon optimization... -
Using AAV for Neuronal Tracing
TypeBlog Post...often made Cre-dependent. If Cre-dependent vectors are used in transgenic animals that express Cre in only...conditional mutant mouse brain that expressed Cre recombinase only in pyramidal cells of the hippocampal ...labelling the subset of infected cells that also express Cre. Another advantage of AAV vectors is that there are... traced neurons with an AAV9 vector expressing a Cre-dependent fluorescent marker. Injection into a conditional...PMID: 4107258. Lo, L., and Anderson, D.J. (2011). A Cre-dependent, anterograde transsynaptic viral tracer... -
Sequencing Primers
TypeGuide...promoter, forward primer CRE-R GCAAACGGACAGAAGCATTT 5' end of Cre recombinase, reverse primer CYC1 GCGTGAATGTAAGCGTGAC... -
Adenovirus Guide
TypeGuide...adenoviral production, and is driven by use of the Cre recombinase. Genome Integration Upon infection, wild-type...contamination have been developed, such as using the Cre-lox and Flp-FRT recombination systems to excise the... forward or reverse orientation, respectively. Created with BioRender.com. Adenoviruses are part of the...adenoviruses have been modified by researchers to create recombinant adenoviral (rAdV) vectors in order ...deletions. Figure 2: First-generation rAdV vectors. Created with BioRender.com. Second-generation rAdV vectors...with first-generation rAdV vectors and further increase the transgene packaging capacity up to ~10.5 kb...vectors. Figure 3: Second-generation rAdV vectors. Created with BioRender.com. Third-generation rAdV vectors... -
28 Hot Plasmid Technologies from 2015
TypeBlog Post...of sequence-specific enzymes (e.g. nucleases, recombinases) which irreversibly excise or invert a specific...upon these findings by screening for additional activation domains that increase the expression of target...Synchronization of secretory protein traffic in mammalian cells The journey of secretory proteins, from their... mutagenized and screened for speed and voltage sensitivity. This hierarchical screen led to the generation...has modified the RNA-guided CRISPR-Cas9 system to create a tool that is quick, versatile, and robust. Dubbed...adopt basic biological concepts and employ them in creative and innovative ways. The principle of protein ...molecule imaging and inducible gene expression by creating the SunTag system. The SunTag system, named after...