...2,500 protocols covering a variety of bio and biomedical topics. Protocol Online Website: http://www.protocol-online.org...

...2021 | Third Edition About This eBook covers practical experimental advice such as tips for planning ... on FRET, biosensors, and monitoring protein localization; an introduction to non-protein fluorophores...First Edition About Our newest eBook contains practical introductions and helpful tips for antibody-based...

...culture Aseptic Technique Aseptic technique is a critical skill for success in numerous fields such as microbiology... AAV Titration by qPCR Use qPCR to measure the physical titer of your adeno-associated virus preparation...

...the attB, P, L and R sites that recombine very specifically and directionally: attB1 sites react only with...

...community is supply chain shortages. When flasks, conical tubes or pipette tips are backordered for months...

...Melatonin for the Timing of Nocturnal Courtship Vocalization. The video summarizes the research of Drs. Feng...

...Genome-Scale, Knockout Screening Pooled CRISPR Libraries Offer Genome-Wide Control for Large-Scale Functional...plasmid, think of each cell carrying it as being a biological replicate for that plasmid. Library screens can...

...mounting medium Laboratory wipes 15 mL conical tubes 50 mL conical tubes Before Starting Refer to the manufacturer's...

...integrate into the genome. This is important because local chromatin structure at the site of genome integration...most suitable virus for therapeutic applications. Clinical trials using AAV for various gene delivery applications...19, termed AAVS1. Instead, the rAAV genome is typically processed into a double-stranded circular episome...

...frequency three orders of magnitude higher than identical targeting vectors delivered through transfection...

...focus or zoom on a camera lens without having to physically rotate the rings around the lens. It allowed ...

...had been more careful. 3. Tell a story We are biologically programmed to listen and remember better when...

...genes are signified with a minus sign (-) as is typically standard; just having the gene listed indicates...

... using, you will be rotating dials behind the numerical display or the top of the plunger of the pipette... to pipette, it’s important for scientists to calibrate their pipettes to make sure that they are properly...

...natural and engineered repressible promoters. Chemically repressible promoters Tet-Off In its native context...

...trendline for the standards. Google Sheets can calculate this for you as follows: In the Chart Editor ,...based on your sample’s HC + LC area. Example calculation: If the sample HC + LC Area is 18179.442 and ...

...the pellet. Air-dry the pellet for 5-10 minutes. Critical It is important to not let the pellet get too ...

...transiently. Are adenoviruses replication deficient? Typically yes, because the early genes necessary for replication...for generation of recombinant adenoviruses: A Practical Guide for using the AdEasy™ System (127 KB) . ...

...IRES, reverse primer L4440 AGCGAGTCAGTGAGCGAG (Caldwell lab) 5' of MCS in L4440 vector, forward primer...LacZ, reverse primer LexA CGTCAGCAGAGCTTCACCATTG (Caldwell lab) 3' end of LexA DNA binding domain, forward...

...is done via a single recombination reaction, drastically simplifying the process and reducing the amount...TOPO Cloning ) Toposiomerase based cloning, often called TOPO® cloning or TA cloning, is a method that relies...