Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 16 results for: CAL

Showing: 1 - 16 of 16 results

  1. Optogenetics Guide

    Type
    Guide
    ...and optical switches Sensors are genetically-encoded reporters of molecular signals; e.g., calcium indicators...Deisseroth K. 2005. Millisecond-timescale, genetically targeted optical control of neural activity. Nat... utilized to control the localization of a protein of interest. A genetically-encoded nuclear Cry2 fusion...MJ. 2006. Next-generation optical technologies for illuminating genetically targeted brain circuits. J...17375185 Kim B, Lin MZ. 2013. Optobiology: optical control of biological processes via protein engineering. Biochem... including explanations of microbial opsin and optical switch terminology. Science...Optogenetics Guide Introduction Microbial Opsins Optical Switches References Introduction The field of optogenetics...

  2. Antibody Guide

    Type
    Guide
    ...antibody’s constant region - specifically, it is determined by a region called the “heavy chain constant ...reagents are molecular tools used in the lab to specifically and tightly bind to other proteins. Antibodies...interest. The protein that an antibody recognizes is called an antigen, while the specific binding site is ...referred to as an epitope. Production Antibodies are typically produced in one of three different methods: in...independently manipulated. Antibodies produced this way are called recombinant antibodies. Recombinant antibodies ...are responsible for binding the antigen, and are called the antigen binding fragments (Fab). The tips of...the Y structure and the lower part of the arms is called the constant region, and is shown in dark blue ...

  3. CRISPR Guide

    Type
    Guide
    ... of identical bases. Browse Plasmids: Prime Edit Large Scale Edits CRISPR can generate large-scale genetic...takes place during the S and G2 phases. Chemically or genetically inhibiting genes involved in NHEJ or upregulating...properties, often called a reeling mechanism. The targeted strand is cleaved non-specifically by Cas3 along...immunoprecipitation (enChIP) using CRISPR. Biochemical and Biophysical Research Communications . 439 (1), 132... generating gRNAs makes CRISPR one of the most scalable genome editing technologies, making CRISPR perfect...gRNAs will be expressed in the same cell. This is called multiplexing , and increases the likelihood that...DNA with no homology elsewhere in the genome. Realistically, most gRNA targeting sequences will have additional...

  4. Chemogenetics Guide

    Type
    Guide
    ...responded to a clinically approved drug, the PSAM domain was engineered to respond specifically to the anti-smoking...coelenterazine (CTZ) or chemical variations thereof (hCTZ), or furimazine (Fz) or chemical variations thereof...integrate opto- and chemogenetics by using physical and biological light sources for opsin activation. Proc...unique and not a common property of either typical or atypical antipsychotic drugs: is M1 agonism a pre-...Inhibitory luminopsins: genetically-encoded bioluminescent opsins for versatile, scalable, and hardware-independent...been shown to be involved in a wide variety of biological processes, including initiating signaling pathways...ligands, could be activated by synthetic ligands. Specifically, Receptors Activated Solely by Synthetic Ligands...

  5. Lentiviral Vector Guide

    Type
    Guide
    ...vectors are common in clinical applications, like gene therapy, as you can more specifically dictate the target..., whereas gamma-retroviruses can only infect mitotically active cell types. This means that lentiviruses...Lentiviral Vectors The genome of lentiviruses typically ranges from 8–10 kb, encoded on RNA (Figure 1)...This process requires a production cell line, typically human embryonic kidney 293T (HEK293T) cells. Standard...there are some HEK293T cell lines that have been specifically engineered for lentiviral production. All lentiviral...altered by changing the envelope gene, a process called pseudotyping. VSV-G is by far the most common envelope...transgene, lentiviral vectors are useful research and clinical tools. Stable Cell Lines Lentiviral vectors can...

  6. Molecular Biology Reference

    Type
    Guide
    ...purification of cellular components, such as DNA, but practically this isolation is only feasible for relatively...Plasmids are fragments of double-stranded DNA that typically carry genes and can replicate independently from...and eukaryotes, they play the most significant biological role in bacteria where they can be passed from...to the field of recombinant DNA, in which many identical DNA fragments can be generated. The combination... 6000 basepairs) to enable easy manipulation. Typically plasmids contain the minimum essential DNA sequences... DNA, and this process of generating multiple identical copies of a recombinant DNA molecule is known ...manipulate genes and other genetic elements using specifically engineered plasmids, commonly referred to as...

  7. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...organism to target large or diffused biological structures. Specifically, researchers were interested in creating...two ITRs with a gene expression cassette that typically contains the transgene of interest. The size of...be included between the ITRs is limited by the physical space available inside of the small AAV capsid...host’s genome. Instead, the linear rAAV DNA is typically processed into a double-stranded circular episome...episomes or concatemers. This avoids the effects local chromatin structures in the host genome can have...gene therapy, neuroscience research, and other biomedical fields. Gene Therapy One of the major applications...A and B, and Duchenne muscular dystrophy. Many clinical trials of AAV-based gene therapies are underway...

  8. Gamma-Retroviral Vector Guide

    Type
    Guide
    ..., whereas gamma-retroviruses can only infect mitotically active cell types. This means that lentiviruses...altered by changing the envelope gene, a process called pseudotyping. VSV-G is by far the most common envelope...commonly used in gene therapy applications to more specifically direct delivery of gene therapies. Common Uses...gamma-retroviral vectors are useful research and clinical tools thanks to their long-term expression of ...protocols for fast and efficient generation of large-scale, high-titer preps. This is thanks to established...lines that are able to keep up with the demand of clinical studies and commercial purposes. The use of helper-free... Khinder, R., . . . Pule, M. (2022). Efficient clinical-grade gamma-retroviral vector purification by ...

  9. Promoters

    Type
    Guide
    ...100-1000 base pairs long and are adjacent and typically upstream (5’) of the sense or coding strand of...transcribed by the RNA polymerase. DNA sequences called response elements are located within promoter regions... sequence thought to be functionally equivalent called the Pribnow box which usually consists of the six...Promoter The final portion of the promoter region is called the distal promoter which is upstream of the proximal...back on itself which helps to explain how many physically distant DNA sequences can affect transcription... -35 position, simply titled the -35 element, typically consists of the sequence TTGACA and this element... operator. Operons are common in prokayotes, specifically bacteria, but have also been discovered in eukaryotes...

  10. Plan Your Experiment

    Type
    Guide
    ...EF1alpha, CBh) or inducible (Tet-ON); U6 promoter is typically used for gRNA May contain reporter gene (e.g. ...needs to match the target locus, but it is also critical to ensure that the gRNA target sequence does NOT...target with no homology elsewhere in the genome. Realistically, a given gRNA target sequence will have partial...additional sites throughout the genome. These sites are called off-targets and should be examined during gRNA ...

  11. Addgene's eBook Collection

    Type
    Guide
    ...2021 | Third Edition About This eBook covers practical experimental advice such as tips for planning ... on FRET, biosensors, and monitoring protein localization; an introduction to non-protein fluorophores...First Edition About Our newest eBook contains practical introductions and helpful tips for antibody-based...

  12. Guide to Using Pooled Libraries

    Type
    Guide
    ...Genome-Scale, Knockout Screening Pooled CRISPR Libraries Offer Genome-Wide Control for Large-Scale Functional...plasmid, think of each cell carrying it as being a biological replicate for that plasmid. Library screens can...

  13. Adenovirus Guide

    Type
    Guide
    ...be included between the ITRs is limited by the physical space available inside of the adenoviral capsid...contain E4. Download the Bert Vogelstein’s lab practical guide for using the AdEasy™ system . Find plasmids...packaging cell line. Recombinant adenoviral vectors typically do not integrate in the host genome and instead...

  14. Sequencing Primers

    Type
    Guide
    ...IRES, reverse primer L4440 AGCGAGTCAGTGAGCGAG (Caldwell lab) 5' of MCS in L4440 vector, forward primer...LacZ, reverse primer LexA CGTCAGCAGAGCTTCACCATTG (Caldwell lab) 3' end of LexA DNA binding domain, forward...

  15. Cloning

    Type
    Guide
    ...is done via a single recombination reaction, drastically simplifying the process and reducing the amount...TOPO Cloning ) Toposiomerase based cloning, often called TOPO® cloning or TA cloning, is a method that relies...

  16. Science Guides

    Type
    Guide
    ...Chemogenetics Chemogenetics is a technique that uses genetically engineered receptors to selectively control and...
Showing: 1 - 16 of 16 results