We narrowed to 985 results for: nin

...check this before incubating your plate. In the morning, single colonies should be visible. A single colony...

...portion of a sequencing reaction: Sequence near the beginning or end of a sequencing reaction is often unreliable...

...allows researchers to easily isolate bacteria containing that plasmid from bacteria that do not contain...

...to read the SDS (Safety Data Sheet) for safety warnings and hazards for these reagents. Work in a well-ventilated...

...origin Forward pAd-CMV GCTAGAGATCTGGTACCGTC For cloning sites after SalI in pAd-CMV vector Forward pBABE...