Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 17 results for: nin

Showing: 1 - 17 of 17 results

  1. Cloning

    Type
    Guide
    ... a Molecular Cloning Technique Molecular Cloning Techniques You may also like... Cloning Resources Empty...101: Restriction cloning ) Back to Top Gateway® Recombination Cloning Gateway cloning (Image from Plasmid...Plasmid 101: Gateway Cloning ) Gateway® cloning is a recombination based cloning method. The benefit of ...via gateway cloning. Back to Top TOPO® Cloning TOPO (Image from Plasmid 101: TOPO Cloning ) Toposiomerase...Toposiomerase based cloning, often called TOPO® cloning or TA cloning, is a method that relies on the hybridization...MoClo and Golden Gate cloning kits for your next cloning project. Golden Gate Cloning (Image from Plasmid...Golden Gate Cloning ) Back to Top Ligation Independent Cloning Ligation Independent Cloning (LIC) relies...

  2. Molecular Biology Reference

    Type
    Guide
    ...plasmid types: Cloning Plasmids - Used to facilitate the cloning of DNA fragments. Cloning vectors tend ...comprised of 4 nucleotides or bases, adenine, thymine, cytosine, and guanine (abbreviated to A, T, C, and G ... is known as DNA or molecular cloning . The process of molecular cloning enabled scientists to break chromosomes...about different types of cloning methods check out our guide on molecular cloning techniques . Plasmid Elements.... With current cloning technology, it is easy to create and modify plasmids containing the genetic element...optimized to help in the initial cloning of a DNA fragment. Commonly used cloning vectors include Gateway entry...expressed, allows only plasmid-containing bacteria to grow in or on media containing that antibiotic. These antibiotic...

  3. CRISPR Guide

    Type
    Guide
    .... P., White, M. F., Yakunin, A. F., Garrett, R. A., Van Der Oost, J., . . . Koonin, E. V. (2015). An updated...in your lab, from knockouts to pooled library screening. Science...CRISPR Basics Small Edits Large Edits Genome-Wide Screening Cas9 Fusion Tools Cas9 Alternatives Resources ...the efficient but error-prone non-homologous end joining (NHEJ) pathway and the less efficient but high-... , and increases the likelihood that any cell containing the CRISPR plasmid will have all desired genomic...researchers to target anywhere from 2–7 genetic loci by cloning multiple gRNAs into a single plasmid — though some...coding sequence ~1 kb shorter than SpCas9 while retaining the same basic function. Its size allows it to...

  4. Adenovirus Guide

    Type
    Guide
    ...BioRender.com. Adenoviral Vector Production Cloning Cloning your transgene, gRNA, or shRNA of interest ...plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be sure to... coli cells containing pAdEasy. pAdEasy is a ~33 kb adenoviral backbone plasmid containing the adenoviral...shuttle plasmid containing the transgene of interest, and the adenoviral plasmid containing the adenoviral...(AdV) are medium-sized, non-enveloped viruses containing a linear double-stranded DNA (dsDNA) genome. ...Shuttle plasmid (also known as transfer plasmid) — containing the transgene of interest, the ITRs, and homology... the adenoviral plasmid. Adenoviral plasmid — containing the rest of the adenoviral genome necessary for...

  5. Lentiviral Vector Guide

    Type
    Guide
    ...lentiviral plasmids. Lentiviral Vector Production Cloning Cloning your transgene, gRNA, or shRNA of interest ...plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be sure to...retro”. Lentiviruses have more complex genomes, containing packaging genes and accessory genes specific ...transfer plasmid can be done with most standard cloning methods, including restriction enzyme, Gibson Assembly...restriction sites or may only be compatible with certain cloning methods (such as a Gateway destination vector),...However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain is necessary...necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular Biology...

  6. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...BioRender.com. Gamma-Retroviral Vector Production Cloning Cloning your transgene, gRNA, or shRNA of interest ...plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be sure to...of “retro”. Retroviruses have simpler genomes, containing only the necessary packaging genes, while lentiviruses...transfer plasmid can be done with most standard cloning methods, including restriction enzyme, Gibson Assembly...restriction sites or may only be compatible with certain cloning methods (such as a Gateway destination vector),...However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain is necessary...necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular Biology...

  7. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ... with BioRender.com. AAV Vector Production Cloning Cloning your transgene, gRNA, or shRNA of interest ...plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be sure to...Viruses (AAV) are small, non-enveloped viruses containing a small, linear single-stranded DNA (ssDNA) genome...Transfer plasmid (also known as cis plasmid) — containing the transgene of interest between the two ITRs...Packaging plasmid (also known as Rep/Cap plasmid) — containing the Rep and Cap regions necessary for the production...and assembly of viral capsids. Helper plasmid — containing adenoviral genes not present in the AAV genome...transfer plasmid can be done with most standard cloning methods, including restriction enzyme, Gibson Assembly...

  8. Plan Your Experiment

    Type
    Guide
    ...should sequence the region you are planning to modify prior to designing your gRNA, as sequence variation... into plasmids containing the gRNA scaffold using standard restriction-ligation cloning. However, the ...amplification of targeted region from DNA, subcloning into a plasmid, and screening individual clones. PCR amplification...sequence. For example, gRNA targeting sequences containing a G nucleotide at position 20 (1 bp upstream ...of the PAM) may be more efficacious than gRNAs containing a C nucleotide at the same position in spite ...design software ). Additionally, many plasmids containing validated gRNAs are now available through Addgene...the exact cloning strategy will depend on the gRNA vector you have chosen, so it is best to review the protocol...

  9. Guide to Using Pooled Libraries

    Type
    Guide
    ...represent a powerful tool for forward genetic screening, or identifying previously unknown genes that ...the Moffat lab has over 175,000 different gRNA-containing plasmids). Amplifying and Using the Library Once...and resistance to to the nucleotide analog 6-thioguanine . Next-generation sequencing is the only way ...that you have access to this technology if you’re planning to conduct a pooled library screen. The figure...used. Below are the general steps to take in the screening process. Amplify the library (electroporation ...pass selection (in the case of a reporter) Sort “winning” cells Sequence those cells that pass (“win”) Get...CRISPR guide for more information on genome-wide screening with CRISPR/Cas9 . Browse our Viral Vector resources...

  10. Optogenetics Guide

    Type
    Guide
    ...Young A, Klapoetke NC, Henninger MA, Kodandaramaiah SB, et al. 2014. Noninvasive optical inhibition with...manipulate cells (frequently neurons) and their governing biomolecular processes. The tools and technologies... by light, these channels and pumps respond by opening or closing, which conducts the flow of ions into...precise spatiotemporal control of these neurons by turning on and off the light source. Optogenetics has been....1 540 Plan Your Optogenetics Experiment When designing your optogenetics experiment, you’ll need to pick...light-inducible dimerization tags (TULIPs), plasmids allow cloning of protein coding sequences with GFP-LOVpep, cpPDZ...

  11. Antibody Guide

    Type
    Guide
    ...antibodies. Recombinant antibodies are created by cloning antibody genes from specific hybridoma cells into... two types of antigen specificity: monoclonal, meaning many copies of one clone that are specific to a... a certain epitope, or polyclonal, meaning there are many clones that are specific to multiple epitopes...using permeabilization, antigen retrieval, and/or sectioning. Block to reduce non-specific binding of antibodies...panels used currently are in the mid-forties. When designing a multiplex assay, selection of the fluorophores... your target epitope in the assay type you are running. Sufficient validation data specific to your antibody...Validation of an antibody is a process separate from running appropriate controls in your assay. There are five...

  12. Educational Resources

    Type
    Guide
    ...plasmid cloning, and virus, including: Gel Electrophoresis Bacterial Transformation Plasmid Cloning Creating...Plasmid? Genetic Code Strain Information Molecular Cloning Techniques Protocols Find written and video protocols...

  13. Science Guides

    Type
    Guide
    ...created the following guides to help you start learning about various scientific concepts related to our...background information on CRISPR and the basics for planning your first CRISPR experiment. Read More Optogenetics...manipulate cells (frequently neurons) and their governing biomolecular processes. The tools and technologies...

  14. Addgene's eBook Collection

    Type
    Guide
    ...experimental advice such as tips for planning your CRISPR experiment and designing your gRNA and how to use pooled...nomenclature, and uses to common promoters and cloning techniques! Close About Overlay Select CRISPR 101...

  15. Chemogenetics Guide

    Type
    Guide
    ...Chemogenetic Receptors: RASSLs DREADDs PSAMs LMOs Planning Your Experiment References Chemogenetic tools ...PSAM-5HT3 LGICs pair a PSAM domain with a 5-HT 3 serotonin receptor sodium- or potassium-selective IPD. Binding... Browse Addgene's collection of LMO plasmids ! Planning Your Chemogenetics Experiment If you're starting...

  16. Promoters

    Type
    Guide
    ...RNA expression UAS Specific Drosophila promoter containing Gal4 binding sites Bacterial Promoters Promoters...

  17. Sequencing Primers

    Type
    Guide
    ...forward primer pAd-CMV GCTAGAGATCTGGTACCGTC For cloning sites after SalI in pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC...
Showing: 1 - 17 of 17 results