Skip to main content

We narrowed to 17 results for: nin

Showing: 1 - 17 of 17 results
  1. Molecular Cloning Techniques

    Type
    Guide
    ...BioRender.com. TOPO Cloning Toposiomerase-based cloning, often called TOPO cloning or TA cloning, is a method... Gateway Recombination Cloning Gateway cloning is a recombination-based cloning method. During Gateway...Golden Gate cloning kits for your next cloning project. Read more in our Golden Gate Cloning blog post ...Gate cloning. Created with BioRender.com. Ligation Independent Cloning Ligation Independent Cloning (LIC...independent cloning Addgene Blogs Plasmids 101: Restriction Cloning Plasmids 101: Gateway Cloning Plasmids...about different molecular cloning techniques, focusing on seven common cloning methods. Educational...Molecular Biology Reference Molecular Cloning Techniques Molecular Cloning Techniques Restriction Enzyme Gateway...
  2. Modular Cloning Guide

    Type
    Guide
    ...Biology Reference Molecular Cloning Techniques MoClo Guide Modular Cloning (MoClo) Guide You may also ...Kits Blog: Plasmids 101 Modular Cloning Blog: Plasmids 101 Modular Cloning Applications and Kits Blog: Plasmids... Plasmids 101 Golden Gate Cloning Synthetic Biology Plasmids Modular Cloning (or MoClo) is a system for...assembly steps. Before beginning, scientists insert fragments of DNA containing basic parts (promoters...enzymes, and mechanisms. zCas9i cloning kit: MoClo-compatible CRISPR/Cas9 cloning kit with intronized Cas9 Genome...RVD TALEN inserts in one cloning step rather than two. Golden GATEway Cloning Kit Other, Zebrafish Expression...Learn about modular cloning (MoClo) and find MoClo kits deposited with Addgene, including the MoClo Toolkit...
  3. Molecular Biology Reference

    Type
    Guide
    ...Addgene Resource(s) Cloning Plasmids Used to facilitate the cloning of DNA fragments. Cloning vectors tend to...comprised of four nucleotide bases: adenine, thymine, cytosine, and guanine (abbreviated to A, T, C, and G,.... With current cloning technology, it is easy to create and modify plasmids containing the genetic element...plasmid-containing bacteria by providing a survival advantage to the bacterial host. Multiple Cloning Site...optimized to help in the initial cloning of a DNA fragment. Commonly used cloning vectors include Gateway entry...entry vectors and TOPO cloning vectors. Empty Backbones , Cloning Kits Expression Plasmids Used for gene...molecule is known as DNA or molecular cloning. The advent of molecular cloning enabled scientists to break chromosomes...
  4. CRISPR Guide

    Type
    Guide
    .... P., White, M. F., Yakunin, A. F., Garrett, R. A., Van Der Oost, J., . . . Koonin, E. V. (2015). An updated...in your lab, from knockouts to pooled library screening. Science...CRISPR Basics Small Edits Large Edits Genome-Wide Screening Cas9 Fusion Tools Cas9 Alternatives Resources ...the efficient but error-prone non-homologous end joining (NHEJ) pathway and the less efficient but high-... , and increases the likelihood that any cell containing the CRISPR plasmid will have all desired genomic...researchers to target anywhere from 2–7 genetic loci by cloning multiple gRNAs into a single plasmid — though some...coding sequence ~1 kb shorter than SpCas9 while retaining the same basic function. Its size allows it to...
  5. Adenovirus Guide

    Type
    Guide
    ...BioRender.com. Adenoviral Vector Production Cloning Cloning your transgene, gRNA, or shRNA of interest ...plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be sure to... coli cells containing pAdEasy. pAdEasy is a ~33 kb adenoviral backbone plasmid containing the adenoviral...shuttle plasmid containing the transgene of interest, and the adenoviral plasmid containing the adenoviral...(AdV) are medium-sized, non-enveloped viruses containing a linear double-stranded DNA (dsDNA) genome. ...Shuttle plasmid (also known as transfer plasmid) — containing the transgene of interest, the ITRs, and homology... the adenoviral plasmid. Adenoviral plasmid — containing the rest of the adenoviral genome necessary for...
  6. Plan Your Experiment

    Type
    Guide
    ...experiment, including selecting the edit type, designing and cloning a gRNA, delivering Cas and the gRNA, and... are a few factors to keep in mind when designing and cloning your gRNAs. Select Genetic Element to be... into plasmids containing the gRNA scaffold using standard restriction-ligation cloning. However, the ...your experimental goal, you are ready to start designing the specific components (Cas enzyme and guide ...the next section, we will cover strategies for designing the gRNA component for each category. Genetic ... cells will use error-prone non-homologous end joining (NHEJ) at the cut site Cas9 or Cas9 nickase High-fidelity... comes down to location, location, location. Positioning your chosen Cas enzyme at the right spot within...
  7. Lentiviral Vector Guide

    Type
    Guide
    ...lentiviral plasmids. Lentiviral Vector Production Cloning Cloning your transgene, gRNA, or shRNA of interest ...plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be sure to...retro”. Lentiviruses have more complex genomes, containing packaging genes and accessory genes specific ...transfer plasmid can be done with most standard cloning methods, including restriction enzyme, Gibson Assembly...restriction sites or may only be compatible with certain cloning methods (such as a Gateway destination vector),...However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain is necessary...necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular Biology...
  8. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...BioRender.com. Gamma-Retroviral Vector Production Cloning Cloning your transgene, gRNA, or shRNA of interest ...plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be sure to...of “retro”. Retroviruses have simpler genomes, containing only the necessary packaging genes, while lentiviruses...transfer plasmid can be done with most standard cloning methods, including restriction enzyme, Gibson Assembly...restriction sites or may only be compatible with certain cloning methods (such as a Gateway destination vector),...However, if the plasmid contains a Gateway cassette containing the ccdB gene, a ccdB-resistant strain is necessary...necessary. For more information on cloning and working with plasmids, visit Addgene’s Molecular Biology...
  9. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ... with BioRender.com. AAV Vector Production Cloning Cloning your transgene, gRNA, or shRNA of interest ...plasmid is compatible with cloning methods available in your lab. When cloning your plasmids, be sure to...Viruses (AAV) are small, non-enveloped viruses containing a small, linear single-stranded DNA (ssDNA) genome...Transfer plasmid (also known as cis plasmid) — containing the transgene of interest between the two ITRs...Packaging plasmid (also known as Rep/Cap plasmid) — containing the Rep and Cap regions necessary for the production...and assembly of viral capsids. Helper plasmid — containing adenoviral genes not present in the AAV genome...transfer plasmid can be done with most standard cloning methods, including restriction enzyme, Gibson Assembly...
  10. Guide to Using Pooled Libraries

    Type
    Guide
    ...represent a powerful tool for forward genetic screening, or identifying previously unknown genes that ...the Moffat lab has over 175,000 different gRNA-containing plasmids). Amplifying and Using the Library Once...and resistance to to the nucleotide analog 6-thioguanine . Next-generation sequencing is the only way ...that you have access to this technology if you’re planning to conduct a pooled library screen. Figure 2: ...pass selection (in the case of a reporter) Sort “winning” cells Sequence those cells that pass (“win”) Get...CRISPR guide for more information on genome-wide screening with CRISPR/Cas9 . Browse our Viral Vector resources...some of our most popular libraries! Genome-wide Screening Using CRISPR/Cas9 Lentiviral CRISPR Libraries ...
  11. Optogenetics Guide

    Type
    Guide
    ...manipulate cells (frequently neurons) and their governing biomolecular processes with light. Read this guide... by light, these channels and pumps respond by opening or closing, which conducts the flow of ions into...precise spatiotemporal control of these neurons by turning on and off the light source. Optogenetics has been....1 540 Plan Your Optogenetics Experiment When designing your optogenetics experiment, you'll need to pick...light-inducible dimerization tags (TULIPs), plasmids allow cloning of protein coding sequences with GFP-LOVpep, cpPDZ...Sørensen, A. T., Young, A., Klapoetke, N. C., Henninger, M. A., Kodandaramaiah, S. B., Ogawa, M., Ramanlal...Tye, K. M., Roska, B., … Boyden, E. S. (2014). Noninvasive optical inhibition with a red-shifted microbial...
  12. Antibody Guide

    Type
    Guide
    ...antibodies. Recombinant antibodies are created by cloning antibody genes from specific hybridoma cells into... two types of antigen specificity: monoclonal, meaning many copies of one clone that are specific to a... a certain epitope, or polyclonal, meaning there are many clones that are specific to multiple epitopes...using permeabilization, antigen retrieval, and/or sectioning. Block to reduce non-specific binding of antibodies...panels used currently are in the mid-forties. When designing a multiplex assay, selection of the fluorophores... your target epitope in the assay type you are running. Sufficient validation data specific to your antibody...Validation of an antibody is a process separate from running appropriate controls in your assay. There are five...
  13. Educational Resources

    Type
    Guide
    ...plasmid cloning, and virus, including: Gel Electrophoresis Bacterial Transformation Plasmid Cloning Creating...Plasmid? Genetic Code Strain Information Molecular Cloning Techniques Protocols Find written and video protocols...
  14. Science Guides

    Type
    Guide
    ...created the following guides to help you start learning about various scientific concepts related to our...background information on CRISPR and the basics for planning your first CRISPR experiment. Read More Optogenetics...manipulate cells (frequently neurons) and their governing biomolecular processes. The tools and technologies...
  15. Addgene's eBook Collection

    Type
    Guide
    ...experimental advice such as tips for planning your CRISPR experiment and designing your gRNA and how to use pooled...nomenclature, and uses to common promoters and cloning techniques! Close About Overlay Select CRISPR 101...
  16. Chemogenetics Guide

    Type
    Guide
    ...PSAM-5HT3 LGICs pair a PSAM domain with a 5-HT 3 serotonin receptor sodium- or potassium-selective IPD. Binding..., 2025 Plan Your Chemogenetics Experiment When planning your chemogenetics experiment, here are some things...
  17. Sequencing Primers

    Type
    Guide
    ...origin Forward pAd-CMV GCTAGAGATCTGGTACCGTC For cloning sites after SalI in pAd-CMV vector Forward pBABE...
Showing: 1 - 17 of 17 results