We narrowed to 1,043 results for: STI;
-
TypeProtocol...Plasmid You may also like... How to Design a Primer Diagnostic Restriction Digest Introduction Sequence verification...the peaks in the area and make sure they are justifiable peaks. For instance, in the trace file below...
-
Mammalian RNAi Tools
TypeCollection...interference (RNAi) experiments at Addgene; browse by constitutive lentiviral shRNA, cre-regulated lentiviral shRNA... silencing mechanism. It is a useful tool to investigate the roles of specific genes or to knockdown genes...retroviral and AAV backbone options. Plasmids for constitutive expression as well as those that allow for conditional... -
Synthetic Biology - Overview
TypeCollection...Phosphoprotein Kit S. cerevisiae Advanced Gateway Destination Vectors TAL Effectors Zinc Finger Consortium ...community-created BioBricks JBEI - Joint Bio-Energy Institute Synberc - Synthetic Biology Engineering Research...Synthetic Biology - Open access journal Do you have suggestions for other plasmids that should be added to this... -
Ligation Independent Cloning
TypeProtocol...recognition sequence. This can create multiple distinct overhangs with a single enzyme, and remove the...now look like this: Note: Elute your purified digestion and PCR products with sterile water (instead of... -
Centrifugation
TypeProtocol...been placed in the centrifuge before you and may still be on the equipment. Before using the centrifuge...centrifuge. Immediately stop the centrifuge and investigate the issue. When you are finished spinning your... -
Lab Safety for Biosafety Levels One and Two
TypeProtocol...BSL-2). The purpose of the four levels is to distinguish between different types of hazards and to provide...with additional precautions to prevent injuries, ingestion, and exposures to hazardous materials. Video Watch... -
Worm Expression Resources
TypeCollection...community by depositing your useful tools , or by suggesting plasmids for the collection. Return to top Plasmid...on miniMos and MosSCI plasmids can be found on Christian Frøkjær-Jensen's Wormbuilder website. General ...organism C. elegans. Return to top Do you have suggestions for other plasmids that should be added to this... -
Validated gRNA Sequences
TypeCollection...Joung Ebf C. intestinalis GCTGAGGGTTGGACAACAGG 59990 cut S. pyogenes 25336740 Christiaen EGFP A. victoria...negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut S. pyogenes 25336740 Christiaen negative control... -
CRISPR Plasmids - Tagging
TypeCollection...Genetics 2014 Allen Institute for Cell Science Plasmid Collection The Allen Institute for Cell Science has...and EGFP are available at Addgene. Do you have suggestions for other plasmids that should be added to this... -
Rinehart Lab Phosphoprotein Reagents
TypeCollection...changed the way researchers can explore important questions surrounding serine phosphorylation by adding this...improved phosphoprotein yield, rEcoli growth characteristics, and an overall improved ease of use when expressing...precise knowledge of phosphorylated positions for testing phosphoproteomics methods, proteomics search algorithms... -
Cre-Lox and Other Site-Specific Recombinases
TypeCollection...them. Most SSR enzymes are categorized into two distinct families, serine recombinases and tyrosine recombinases...Expression of both fragments in the same cell reconstitutes a functional protein, allowing recombination...Content last reviewed on 31 July 2025. Do you have suggestions for other plasmids that should be added to this... -
AAV Titration by qPCR Using SYBR Green Technology
TypeProtocol...titers were similar to those reported by these institutions. This protocol is for a 96-well plate with 20...reaction volume. Last Update: February 13, 2019 Estimate of time required: ~3 h Workflow Timeline Plate... -
Retrograde AAV viral preps
TypeCollection...construct from Alla Karpova at Janelia Research Institute....staining, in vitro and (when possible) in vivo testing, and full sequencing of the final viral vector ...vector preparation. In some cases, in vivo testing of these viral preparations was performed by the Karpova... -
Affinity Purification of Recombinant Antibodies with Protein A or Protein G
TypeProtocol...should be properly disposed of following your institution’s hazardous waste procedures. Last Update: February...desired concentration. If the sample concentration is still too low, repeat the centrifugation until the volume... -
Genomic Deletions in Mammalian Cell Lines
TypeCollection...For small deletions (as the “deletion band” may still amplify), resolve agarose gel to determine if size...for 20 min). These cycling conditions allow for digestion and ligation to occur in one reaction (see step...conditions for each primer pair designed based on testing the bulk sorted cells. Run samples on 2% agarose... -
AAV ddPCR Titration
TypeProtocol...ensure that you are in compliance with your institution’s biosafety regulations. Equipment Class II, Type... When analyzing data there should be a clear distinction between negative droplets (black) and positive... -
Kit Free RNA Extraction
TypeProtocol...entire tube is dried but while the white pellet is still visible. Resuspend RNA pellet in RNase-free water... -
CRISPR Pooled gRNA Libraries
TypeCollection...Knockout Human Yusa 3rd 5 90,709 Human Interferon-Stimulated Gene CRISPR Knockout Library 125753 Knockout ...Mutation Libraries 229137–229140 Donor Vector Human Stiewe N/A Varies 1,910–3,034 per exon Human Cas13 lncRNA...69,716 SAM v2 - 2 plasmid system 1000000078 (Blasticidin) Activation Human Zhang 3rd 3 70,290 sgRNA libraries... -
Fluorescent Protein Guide: Subcellular Localization
TypeCollection...Fluorescent Protein Resources: Empty Backbones Allen Institute for Cell Science Plasmid Collection FRET Biosensors...-pmCherryC1 Actin Filaments Cortactin mCherry Christien Merrifield 36201 pLifeAct-mTurquoise2 Actin Filaments...Protein Collection . Return to top Do you have suggestions for other plasmids that should be added to this... -
Penn Vector Core Partnership with Addgene
TypeCollection...partnership to provide AAV viral preps, includes listing of transfer status for viral preps....Discontinued Penn Vector Core Viral Vectors (Plasmids still available, other serotypes may be available) Based...Wilson Please contact [email protected] with any questions. Return to top...