...You’ve designed the perfect experiment – controls, conditions, and everything in between – now all you... (FLAG, Myc, etc.) and fluorescent protein tags (GFP, mCherry, etc.). Fluorescent tags are primarily used...

...represent a long-sought tool for researchers to control K+ gradients and can be used as a potent optogenetic...Addgene’s western blot for the myc-tagged protein GFP-smFP-myc expressed from Plasmid 98926. See the Applications...

... pU6-sgGFP-NT1 Human pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GFP (NT1)...contains a human codon optimized dcas9 gene under the control of Murine Stem Cell retroVirus LTR promoter. The...pgRNA_humanized ) contains a murine U6 promoter controlled sgRNA cassette, wherein the GN19 can be custom...as an RNA-Guided Platform for Sequence-Specific Control of Gene Expression. Qi LS, Larson MH, Gilbert LA...vector (Leu2) that contains dCas9 fused to NLS controlled by TDH3 promoter 46921 pTDH3-dCas9-Mxi1 Yeast...and sgRNA targeting GAL4 UAS promoter (negative control) 46918 pU6-sgCD71-2 Human pSico-based U6 vector...Yeast CEN/ARS vector (Ura3) that contains sgRNA controlled by SNR 52 promoter, targeting endogenous TEF1...

...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...negative control CTGGAATGAATTGGCCTATG 68893 interfere S. pyogenes 26918244 Lu negative control M. musculus...negative control synthetic GTCAAGGCACTCTTGCCTA 64955 cut S. pyogenes 25527740 Bleris negative control H. sapiens...GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes...66895 cut S. pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut ...

... under the control of the cI857 temperature-sensitive repressor. The temperature-controlled expression..., Hess et al. successfully evolved wild type GFP to EGFP using CRISPR-X and subsequent FACS sorting. They... at a dose and duration sufficient to kill all control cells and surviving “mutant” colonies were deep...GTPases involved in cell signaling pathways that control many cellular processes such as differentiation...with unique tissue-specific promoters expressing GFP, tetracycline response elements, and shRNAs many ...gRNA backbone plasmids with Addgene. Additional control plasmids for the TKO library will be available ... of DsRed connected to a pH-sensitive variant of GFP (SEP) by a 9 amino-acid linker (see Figure 1). The...

... the two reporters, mCherry and sfgfp in this case, can be controlled using a plasmid‐borne CRISPR array...target sequence lower the repression level. By controlling the number of mismatches we can obtain a range... the tracrRNA sequence (not shown). (B) Relative GFP and RFP concentration given relatively to the non‐targeting...carrying two CRISPR guides. The first one binds to sfgfp with either 0, 10, 11, 14, or 20 matching nucleotides...for these two reporters simultaneously. By fusing sfGFP and/or mCherry to genes of interest, it is thus ...

...both purified CPP-tagged protein and an untagged control could enter cultured cells and activate expression...Neuronal stem cells transduced with iTOP resulting in GFP expression. Image courtesy of Diego D'Astolfo. ...

...activator with 2A GFP 61423 : Expresses the MS2-P65-HSF1 activator helper complex with 2A GFP 61424 : sgRNA...(SapI)_hSyn-GFP-KASH-bGH (SpGuide acceptor). This is a AAV plasmid for sgRNA cloning. GFP-KASH fusion ...PX552; U6 promoter-driven; for sgRNA cloning; has GFP-KASH for FACS sorting SaCas9 + single guide RNA: ...recombinase, and Kras G12D HDR template 60225 : control for AAV-KPL; sgRNA targeted to LacZ, plus luciferase...within the mouse genome. This plasmid is used as a control for AAV-KPL. #60226 - AAV:ITR-U6-sgRNA(backbone...targeting the neuronal-specific gene NeuN. As a control they designed an sgRNA targeting LacZ, which is... recombinase-2A-EGFP-KASH 60231 : sgRNA cloning backbone with Cre recombinase-2A-EGFP-KASH Detailed backbone...

... state-of-the-art NIR FPs can be used similar to GFP-like probes by supplying a single gene to cells. ...2018). NIR FPs can be combined with blue-light controlled optogenetics, such as channelrhodopsins and tools...crosstalk-free three-color imaging with green and red GFP-like FPs (Shcherbakova et al., 2016), as well as ...for miRFPnanos, 35 kDa for miRFPs, and 27 kDa for EGFP) and a possibility to be used as internal tags due... normalization to fluorescence of co-transfected EGFP. e Originally reported as a monomer16, IFP2.0 was...

...protease, Nsp5. Our set also includes a GFP construct as a control. For easier portability, all viral genes...

...terminally tagged fusion proteins with fluorescent (YFP, GFP, CFP, RFP, etc.) or affinity tags (HA, FLAG). There...like to isolate a minimum of five. You have no control over how many insertions occurred. Having too many...segregate 3:1 in the T2 generation. You also have no control over where your construct will be inserted. If ...

...most important ways to spatially and temporally control gene expression, especially in in vivo models, ...-2.1 construct can express one of four colors (n-GFP, RFP, YFP or M-CFP.) The construct contains two tandem...functionally similar to Cre-based Brainbow, but is controlled by FLP/FRT recombinase. When placed under different.... The use of AAV provides spatial and temporal control without the need for germline modification, and... and sequence overlap (coral mOrange2, jellyfish EGFP, and sea anemone mKate2.) They then successfully... is retained in Brainbow-3.0, but with mOrange2, EGFP and mKate2 as the fluorophores; mOrange2 is the ...

...Calcium erGAP3 (GFP-Aequorin Protein) for imaging of Ca+ dynamics in endoplasmic reticulum GFP-Aequorin Protein...FlincG3 (GFP-based cGMP sensor) for imaging in C. elegans neurons Using a Robust and Sensitive GFP-Based ...fluorescence (pMRX-IP-GFP-LC3-RFP) An Autophagic Flux Probe that Releases an Internal Control. Mol Cell. 2016... with different binding affinities or negative-control constructs used to characterize the sensor's behavior...2020 GENIE Project Calcium jGCaMP7 High-performance GFP-based calcium indicators (Constitutive or Cre-dependent... GCaMP6f in PV cortical interneurons under the control of the E2 regulatory element Viral manipulation...in forebrain GABA-ergic interneurons under the control of the mDlx enhancer A viral strategy for targeting...

...vectors in the “controls” category, which includes things like viral vectors that deliver GFP.   Figure...Patrick, M., Guerin, K., & Fan, M. (2023). Quality control for Adeno-associated viral vector production. Neuromethods...

...ones? Many of the available biosensors use a single GFP or CFP/YFP-derived FRET pair. If you need to free...fluorescent state only by simultaneous (1) user-controlled illumination with violet light and (2) exposure...

...undergo application-specific validation and quality control by Addgene as well as by our trusted partner labs...popular markers like tubulin or epitope tags like Myc, GFP, and more. Neuroscience : Antibodies targeting proteins...

...pAAV-CAG-FLEX-Archon1-KGC-EGFP-ER2 CAG Archon1 EGFP Cre dependent 5 Boyden 115892 pAAV-Syn-Archon1-KGC-GFP-ER2 Syn Archon1...Archon1 EGFP Constitutive 8 Boyden 115893 pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2] Syn Archon1 EGFP Cre dependent...proteins, including calcium sensors, under the control of various promoters. Sensor Green Calcium Sensors... 140555 pAAV-hsyn-GRAB_DA-mut Syn GRAB_DA-mut (control) none Constitutive 9 Li 140556 pAAV-hsyn-GRAB_rDA1m...140558 pAAV-hsyn-GRAB_rDA-mut Syn GRAB_rDA-mut (control) none Constitutive 9 Li 208698 pAAV-hSyn-GRAB-gDA3m...pGP-AAV-GFAP-iGABASnFR2(no bind)-WPRE GFAP iGABASnFR2 (control) none Constitutive 1, 5 GENIE 218874 pGP-AAV-syn-iGABASnFR2...pGP-AAV-syn-iGABASnFR2(no bind)-WPRE Syn iGABASnFR2 (control) none Constitutive 1, 5 GENIE 218877 pGP-AAV-syn-flex-iGABASnFR2...

...vectors for C. elegans research, including lacZ and GFP fusion vectors. C. elegans optimized fluorophores...silencing in the germline. A "FLP-Out" system for controlled gene expression in Caenorhabditis elegans. - ...Hubbard Lab. Plasmids for the temporal and spatial control of gene expression in C. elegans by combining expression...

...needed and when is it not? What are the proper controls needed to pressure-test your FRET assay to make...molecular distances (see Table). However, proper control experiments are needed to establish the dynamic...These experiments include producing a positive control construct where the donor and the acceptor fluorophore... each other on the same protein and a negative control experiment conducted on donor-only labeled protein...protein, permeabilized cells  Cy5NTAc 32 25-45 GFP (fluorescein is similar)   Lumio Red Tc: CCPGCC 48...

...Addgene has several great options: pLV hUbC-dCas9-T2A-GFP for removable dCas9 expression and pLM-CMV-R-Cre....Ming G-L, King JR, Song H, Sweatt JD (2013) TET1 Controls CNS 5-Methylcytosine Hydroxylation, Active DNA...