...coli BioBrick plasmids (meffRed, eforRed, asPink, spisPink, scOrange, fwYellow, amilGFP, amajLime, cjBlue...contrast, the widely used green fluorescent protein (GFP) gives a bright green fluorescence when exposed to...at the cells on the plate. For example, if your plasmid contains a gene encoding a blue chromoprotein, ...colonies to determine which cells have taken up the plasmid. Of course, other follow up methods like sequencing...chromoproteins. In some cases, cells containing high-copy plasmid-borne chromoproteins lost color overnight in liquid...problem. There is no single “ideal” chromoprotein plasmid that combines the most desirable features: intense...Chromoproteins for allelic exchange Figure 3: pTOX plasmids expressing amilCP and tsPurple genes. Image: Lazarus...

...soCoChR-GFP Syn CoChR (soma-targeted) GFP Constitutive 9 Boyden 107712 pAAV-hSynapsin-FLEX-soCoChR-GFP Syn...pAAV-hsyn-Jaws-KGC-GFP-ER2 Syn Jaws GFP Constitutive 5, 8, rg* Boyden 84445 pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] CAG...neuroscience to control electrical potentials in neurons. See our Optogenetics Plasmids and Optogenetics...* Deisseroth 58880 pAAV-Syn-ChR2(H134R)-GFP Syn ChR2/H134R GFP Constitutive 8, rg* Boyden 100054 pAAV....Constitutive 9 Harvey 59170 pAAV-Syn-Chronos-GFP Syn Chronos GFP Constitutive 1, 5, rg* Boyden 59171 pAAV-...Constitutive 8 Deisseroth 22222 AAV-FLEX-Arch-GFP CAG Arch GFP Cre dependent 1, 9 Boyden 28305 pAAV-FLEX-...dependent 5 Boyden 99039 pAAV-CamKII-ArchT-GFP (PV2527) CaMKII ArchT GFP Constitutive 1, 5, 9, rg* Boyden 137148...

...cells to retain plasmids - if a cell does not inherit plasmid due to improper plasmid partitioning, it...unstabilized plasmids were retained in less than 10% of cells while plasmids containing the plasmid addiction...ensure that plasmids are passed down through generations (Figure 1). These so called “plasmid addiction ...only survive if they retain the plasmid. Since their discovery, plasmid addiction systems have been used...found that if a mini-F plasmid carried a specific 700 bp segment of DNA, the plasmid was propagated better...selection in one plasmid, they were able to create an efficient cloning tool. The plasmid pKSCTMF contains...restriction-modification systems onto plasmids allowed cell populations to retain more of these plasmids as compared to those...

...with the lentivirus HIV-1. Today, HIV-1 can be controlled with antiviral therapies such that the virus ...activated HIV-1, measured via HIV-1 promoter-driven GFP expression. In cell lines that can produce HIV-1 ...infection period rather than the ART-induced viral control found in most HIV-1 patients. Obstacles for CRISPR...26538064. PubMed Central PMCID: PMC4633726 Find SAM plasmids used in this publication at Addgene. Kaminski...PMC4778041. Find CRISPR and lentiviral packaging plasmids used in this publication at Addgene. Wang Z, ...Addgene’s newly updated CRISPR Guide! Find CRISPR Plasmids for Your Research Browse gRNA Design Tools  ...

...into cells as a donor plasmid containing the transposon, along with a helper plasmid that expresses the ...reprogramming factors. Non-replicating Plasmids: Generating iPSCs with plasmid-based expression requires serial... generating iPSCs by plasmid transfection where 2 of 11 clones tested had plasmid integration. Another...multiple transfection makes it difficult to control the dose of plasmid the cells receive over the whole reprogramming...larger plasmids have lower rates of transfection. Minicircles: Minicircles are like mini-plasmids. They...reflection of the large size of the plasmid or silencing of the plasmid by DNA methylation. Another downside...choose a strategy suited to their research. Find Plasmids for Stem Cell Research Delivery Method Mechanism...

... undergo stringent quality control by Addgene or a trusted quality control partner before distribution... to an untransfected control and the protein size is confirmed. Residual Plasmid Sanger Sequencing Purified... low levels of co-purified plasmid from transfection. This residual plasmid is extracted and amplified...Addgene's antibody production methods and quality control processes for purified recombinant antibodies. ...production protocols, titering methods, and quality control are described below. Information for a specific...embryonic kidney cells are transfected with the plasmid(s) encoding the heavy and light chains. Antibodies...samples with >90% purity are distributed. Quality Control Each lot of antibody undergoes testing, either ...

...Collections Luciferase Plasmids Luciferase Plasmid Collection You may also like... Fluorescent Proteins Blog...luciferase. Plasmids are Gateway cloning compatible. Learn more about DULIP in our 27 Hot Plasmids from 2016....06 : Nonsense-mediated decay reporter and control plasmid utilizing Firefly luciferase. Transcriptional...luciferase reporter. These plasmids improve over the original STARR-seq plasmids by using the bacterial ORI...otherwise noted, these plasmids are meant for expression in mammalian systems. ID Plasmid Luciferase Type(s...luciferase expression plasmids; these are noted with the viral service icon . ID Plasmid Luciferase Type Promoter.... ID Plasmid Description Gene/Insert PI Return to Top Do you have suggestions for other plasmids that ...

... These AAV encode tetracycline-inducible tools/controls and tetracycline transactivators that can be used...Cre-dependent Cre-dependent expression of membrane-bound GFP and synaptophysin-mRuby for labeling of axon terminals...System Activity Serotype PI 124364 pAAV-FLEX-DTR-GFP CBA-driven, Cre-dependent Cre-dependent expression...expression of diphtheria toxin receptor fused to GFP for studying cell ablation. 2 Jessell , Azim 45580 pAAV-...options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral vector prep you need.... Serotype PI 98747 pAAV-FLEX-EGFPL10a EF1a-driven and Cre-dependent EGFP-tagged ribosomal L10a 5, rg* ...and synaptophysin-EGFP for labeling of axon terminals. 1 Zeng 71760 pAAV hSyn FLEx mGFP-2A-Synaptophysin-mRuby...

... with or without GFP and mCherry controls. Do you have suggestions for other plasmids that should be added... Zhang Lab Plasmids The Human TFome Library Stem Cells Protocols & References MORF Plasmids MORF Pooled...out PCR for 10X scRNA-seq (PDF, 59.2 KB) Plasmids ID Plasmid Gene/Insert Pooled Library The MORF pooled... 1,836 genes encoded by 3,548 isoforms and two control vectors. The individual clones, or the pooled library... added to this list? Fill out our Suggest a Plasmid form or e-mail [email protected] to help us improve...

... CRISPR Qi Lab CRISPR Plasmids Qi Labs CRISPR Plasmids Available from... genome. 1. Two-plasmid CRISPRi system for bacterial gene knockdown The first plasmid ( pdCas9_bacteria... both plasmids in bacteria could cause up to 300-fold repress on targeted genes. 2. Two-plasmid CRISPRi...first plasmid ( pdCas9_humanized ) contains a human codon optimized dcas9 gene under the control of Murine...promoter. The second plasmid ( pgRNA_humanized ) contains a murine U6 promoter controlled sgRNA cassette, ... 23849981 . Individual plasmids can be ordered via the links below: ID Plasmid Description 44246 pdCas9...fusion expression plasmid 44248 pgRNA-humanized A customizable gRNA expression plasmid for use with either...

...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...negative control CTGGAATGAATTGGCCTATG 68893 interfere S. pyogenes 26918244 Lu negative control M. musculus...negative control synthetic GTCAAGGCACTCTTGCCTA 64955 cut S. pyogenes 25527740 Bleris negative control H. sapiens...CRISPR experiments. This datatable is compiled from plasmids in Addgene's database as well as from sequences..., the categories described on Addgene's CRISPR Plasmids and Resources page have been used to indicate ...

... reporters, mCherry and sfgfp in this case, can be controlled using a plasmid‐borne CRISPR array coding...collection comprises 20 plasmids, each carrying two CRISPR guides. The first one binds to sfgfp with either 0, ...From the Bikard Lab, CRISPR plasmid collection for modulating expression levels of two targets independently...Repression Collection Bikard Lab CRISPR Repression Plasmids You may also like... CRISPR Guide CRISPR Protocols...target sequence lower the repression level. By controlling the number of mismatches we can obtain a range...18, or 20 matching nucleotides. Together, these plasmids allow to explore the whole range of expression...amount and stoichiometry of enzymes. The pLC97 plasmid allows for quick integration of the aTc-inducible...

...used pairs to measure FRET. The table below lists plasmids that can be used to create your choice of fluorescent... fusion protein with your gene of interest: Plasmid Color Expression Description pPROEX Aqua Cyan...SYFP2 Clover Green Mammalian Expresses Clover (a GFP variant) commonly used with mRuby2 pLSSmOrange-...world and corrective approaches and appropriate controls are required to make this method useful for dynamic...

...26973 AAVrg pAAV-hSyn-hChR2(H134R)-EYFP   Control AAV Control AAV allow researchers to not only interpret...service has now expanded to offer many of our control plasmids in new serotypes. See our Serotype Testing...  AAV1 pAAV-hSyn-DIO-hM4D(Gi)-mCherry Controls Plasmid Serotype Name 50459 AAV1 pAAV-hSyn-DIO-... Nuc-flox(mCherry)-EGFP 50457 AAV2 pAAV-hSyn-DIO-EGFP Recombinases Plasmid Serotype Name 87306...the entire collection! Plasmid Serotype Name 51502 AAV5 pCAG-FLEX-EGFP-WPRE 114471 AAV1, AAV5 pAAV-Ef1a-fDIO...inventory. Our new AAVs include: Optogenetics AAV Control AAV Biosensor AAV And more! Optogenetics Optogenetics...more efficient tools for light mediated neuronal control and we are expanding our viral service to make ...

...tracrRNA: This plasmid contains three expression cassettes. To target a given site, the plasmid can be digested...activator with 2A GFP 61423 : Expresses the MS2-P65-HSF1 activator helper complex with 2A GFP 61424 : sgRNA...sgRNA cloning; has GFP-KASH for FACS sorting SaCas9 + single guide RNA: These plasmids contain two expression...guide acceptor: The PX552 plasmid (#60958) contains pAAV-U6::sgRNA(SapI)_hSyn-GFP-KASH-bGH (SpGuide acceptor...acceptor). This is a AAV plasmid for sgRNA cloning. GFP-KASH fusion facilitates FACS sorting of cells and...adenocarcinoma pathology. These plasmids as well as a backbone plasmid for cloning new targets are described...present within the mouse genome. This plasmid is used as a control for AAV-KPL. #60226 - AAV:ITR-U6-sgRNA...

...Browse fluorescent protein plasmids and resources See all Jaffrey lab plasmids ... cellular processes by transforming cells with plasmids encoding aptamer-tagged RNA and later introducing...aptamer downstream of a known promoter. Addgene’s Plasmids 101: Aptamer Fluorophores describes the enrichment...aptamers able to bind to a small molecule derivative of GFP called 3,5-difluoro-4-hydroxybenzylidene imidazolinone...metabolites, leading to conformational changes that control the expression of coding RNA. Spinach-based riboswitches...

...injury markers were not increased compared to a control AAV-GFP. Not only did the AAV-SaCas9-sgRNA constructs...capabilities of full-length SpCas9. This set of plasmids includes AAV-Cas9C-VPR for targeted gene activation...bacterial immune system cleaves bacteriophage and plasmid DNA. Nature 468:67–71 . https://doi.org/10.1038...Addgene.org Check out our CRISPR Guide Find CRISPR Plasmids ...

...highlight a subset of the new plasmids in the repository through our hot plasmids articles. These brief articles...articles provide a synopsis of a plasmid or group of plasmids' functions and applications. We hope that... you to find and use the plasmids you need. You can find all the hot plasmids from 2017 below. With over...over 50,000 plasmids, we can't write posts for every great plasmid that comes into the repository, but...write about your plasmids in a future blog post. No time to read? Listen to our hot plasmids segment on the...editing for precise genome modification. Plasmid ID Plasmid Name Cas9 Variant Speacial Features 85169... to the Addgene blog to get all the latest hot plasmid updates!     Tol2 Gateway-compatiable toolbox...

...Dangers of Using GFP for Protein Localization Resources on Addgene.org Find Plasmids for Mammalian Cells... laboratories to carry our independent quality control for a range of testing, from animal doping to forensics...

...resources on addgene.org Find Optogenetics Plasmids Find Biosensor Plasmids Visit the Fluorescent Protein Guide...Frank Hayward et al., 2024). They deposited their plasmid with Addgene, hoping to inspire others to explore... of a magnetoresponsive fluorescent protein. Controlling an optogenetic or fluorescent tool with magnets... 2016), and some previous attempts at magnetic control of biological systems (Wheeler et al., 2016; Duret...Lab is eager to hear from you. Find the MagLOV plasmid here!   References and resources References Duret...T., York, A. G., Ingaramo, M. (2024). Magnetic control of the brightness of fluorescent proteins. Zenodo...Güler, A. D. (2016). Genetically targeted magnetic control of the nervous system. Nature Neuroscience, 19(...