Skip to main content
Addgene

We narrowed to 155 results for: gfp control plasmid

Showing: 101 - 120 of 155 results
  1. Hot Plasmids: Spring 2025

    Type
    Blog Post
    ...more? Explore our empty and EGFP retroviral plasmid set, our bacterial plasmid set for expressing tagged...of the new plasmids, antibodies, and viral preps in the repository through our Hot Plasmids articles. ...and AAV plasmid sets launching later this year!  Find Addgene's own Lentiviral backbone plasmids here! ... synaptic imaging applications. Find iGluSnFR4 plasmids here! Aggarwal, A., Negrean, A., Chen, Y., Iyer...powerful tools in a scientist's toolkit is the empty plasmid backbone: the DNA vector that contains everything... swap sequences effortlessly.  We built these plasmids for flexibility and speed, so you can design, ...and labeled with primary antibody (0.01 µg/mL Anti-GFP [N86/38.1R] (Addgene #180084), 0.01 µg/mL Anti-HA...
  2. Bacterial Toxin-antitoxin Systems as Molecular Biology Tools

    Type
    Blog Post
    ...cells to retain plasmids - if a cell does not inherit plasmid due to improper plasmid partitioning, it...unstabilized plasmids were retained in less than 10% of cells while plasmids containing the plasmid addiction...ensure that plasmids are passed down through generations (Figure 1). These so called “plasmid addiction ...only survive if they retain the plasmid. Since their discovery, plasmid addiction systems have been used...found that if a mini-F plasmid carried a specific 700 bp segment of DNA, the plasmid was propagated better...selection in one plasmid, they were able to create an efficient cloning tool. The plasmid pKSCTMF contains...restriction-modification systems onto plasmids allowed cell populations to retain more of these plasmids as compared to those...
  3. Luciferase Plasmid Collection

    Type
    Collection
    ...Luciferase Plasmids Luciferase Plasmid Collection Empty Backbones Expression Constructs Reporter Constructs...otherwise noted, these plasmids are meant for expression in mammalian systems. ID Plasmid Luciferase Type(s...preparations of select luciferase expression plasmids. ID Plasmid Luciferase Type Promoter Description PI ...suggestions for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail...Root 105533 pAAV.CMV.Luc.IRES.EGFP.SV40 Firefly CMV AAV expression of firefly luciferase and GFP James Wilson...of luciferase plasmids for gene expression assays and bioluminescent reporters. Plasmid... Plasmid Collections Luciferase...
  4. Targeting HIV-1 with CRISPR: Shock and Kill or Cut it Out?

    Type
    Blog Post
    ...with the lentivirus HIV-1. Today, HIV-1 can be controlled with antiviral therapies such that the virus ...activated HIV-1, measured via HIV-1 promoter-driven GFP expression. In cell lines that can produce HIV-1 ...infection period rather than the ART-induced viral control found in most HIV-1 patients. Obstacles for CRISPR...26538064. PubMed Central PMCID: PMC4633726 Find SAM plasmids used in this publication at Addgene. Kaminski...PMC4778041. Find CRISPR and lentiviral packaging plasmids used in this publication at Addgene. Wang Z, ...Addgene’s newly updated CRISPR Guide! Find CRISPR Plasmids for Your Research Browse gRNA Design Tools  ...
  5. Delivery Methods for Generating iPSCs

    Type
    Blog Post
    ...into cells as a donor plasmid containing the transposon, along with a helper plasmid that expresses the ...reprogramming factors. Non-replicating Plasmids: Generating iPSCs with plasmid-based expression requires serial... generating iPSCs by plasmid transfection where 2 of 11 clones tested had plasmid integration. Another...multiple transfection makes it difficult to control the dose of plasmid the cells receive over the whole reprogramming...larger plasmids have lower rates of transfection. Minicircles: Minicircles are like mini-plasmids. They...reflection of the large size of the plasmid or silencing of the plasmid by DNA methylation. Another downside...choose a strategy suited to their research. Find Plasmids for Stem Cell Research Delivery Method Mechanism...
  6. Antibody Production

    Type
    Collection
    ... undergo stringent quality control by Addgene or a trusted quality control partner before distribution... to an untransfected control and the protein size is confirmed. Residual Plasmid Sanger Sequencing Purified... low levels of co-purified plasmid from transfection. This residual plasmid is extracted and amplified...Addgene's antibody production methods and quality control processes for purified recombinant antibodies. ...production protocols, titering methods, and quality control are described below. Information for a specific...embryonic kidney cells are transfected with the plasmid(s) encoding the heavy and light chains. Antibodies...samples with >90% purity are distributed. Quality Control Each lot of antibody undergoes testing, either ...
  7. AAV Molecular Tools

    Type
    Collection
    ... These AAV encode tetracycline-inducible tools/controls and tetracycline transactivators that can be used...Cre-dependent Cre-dependent expression of membrane-bound GFP and synaptophysin-mRuby for labeling of axon terminals...System Activity Serotype PI 124364 pAAV-FLEX-DTR-GFP CBA-driven, Cre-dependent Cre-dependent expression...expression of diphtheria toxin receptor fused to GFP for studying cell ablation. 2 Jessell , Azim 45580 pAAV-...options. Select from a vast catalog of eligible AAV plasmids and we’ll make the viral vector prep you need.... Serotype PI 98747 pAAV-FLEX-EGFPL10a EF1a-driven and Cre-dependent EGFP-tagged ribosomal L10a 5, rg* ...and synaptophysin-EGFP for labeling of axon terminals. 1 Zeng 71760 pAAV hSyn FLEx mGFP-2A-Synaptophysin-mRuby...
  8. Feng Zhang Multiplexed Overexpression of Regulatory Factors (MORF) Collection

    Type
    Collection
    ... with or without GFP and mCherry controls. Do you have suggestions for other plasmids that should be added... Zhang Lab Plasmids The Human TFome Library Stem Cells Protocols & References MORF Plasmids MORF Pooled...out PCR for 10X scRNA-seq (PDF, 59.2 KB) Plasmids ID Plasmid Gene/Insert Pooled Library The MORF pooled... 1,836 genes encoded by 3,548 isoforms and two control vectors. The individual clones, or the pooled library... added to this list? Fill out our Suggest a Plasmid form or e-mail [email protected] to help us improve...
  9. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    ...easiest way is to co-transfect several plasmid together, with each plasmid having a targeting spacer cloned ...experiment, consider co-transfecting with GFP. This allows you to sort for GFP-positive cells and to enrich for...articles (3/12/2014). With so many options for CRISPR plasmid tools and numerous experimental design decisions...Engineering Using CRISPR/Cas Systems has expanded out of control. To further consolidate these FAQs, Le Cong worked...with expression, though it is possible for the plasmid to still express without the G. Because the G is...experiments for multiplexed targeting with Zhang lab plasmids? A6: For multiplexing CRISPR to target multiple...into PX330, then co-transfect or delivery the two plasmids together into your cells. If you want to use double...
  10. Validated gRNA Sequences

    Type
    Collection
    ...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...negative control CTGGAATGAATTGGCCTATG 68893 interfere S. pyogenes 26918244 Lu negative control M. musculus...negative control synthetic GTCAAGGCACTCTTGCCTA 64955 cut S. pyogenes 25527740 Bleris negative control H. sapiens...CRISPR experiments. This datatable is compiled from plasmids in Addgene's database as well as from sequences..., the categories described on Addgene's CRISPR Plasmids and Resources page have been used to indicate ...
  11. Tips for Using FRET in Your Experiments

    Type
    Blog Post
    ...used pairs to measure FRET. The table below lists plasmids that can be used to create your choice of fluorescent... fusion protein with your gene of interest: Plasmid Color Expression Description pPROEX Aqua Cyan...SYFP2 Clover Green Mammalian Expresses Clover (a GFP variant) commonly used with mRuby2 pLSSmOrange-...world and corrective approaches and appropriate controls are required to make this method useful for dynamic...
  12. Bikard Lab - CRISPR Repression Collection

    Type
    Collection
    ... reporters, mCherry and sfgfp in this case, can be controlled using a plasmid‐borne CRISPR array coding...collection comprises 20 plasmids, each carrying two CRISPR guides. The first one binds to sfgfp with either 0, ...From the Bikard Lab, CRISPR plasmid collection for modulating expression levels of two targets independently...Repression Collection Bikard Lab CRISPR Repression Plasmids You may also like... CRISPR Guide CRISPR Protocols...target sequence lower the repression level. By controlling the number of mismatches we can obtain a range...18, or 20 matching nucleotides. Together, these plasmids allow to explore the whole range of expression...amount and stoichiometry of enzymes. The pLC97 plasmid allows for quick integration of the aTc-inducible...
  13. New and Upcoming Viral Vectors - December 2019

    Type
    Blog Post
    ...26973 AAVrg pAAV-hSyn-hChR2(H134R)-EYFP   Control AAV Control AAV allow researchers to not only interpret...service has now expanded to offer many of our control plasmids in new serotypes. See our Serotype Testing...  AAV1 pAAV-hSyn-DIO-hM4D(Gi)-mCherry Controls Plasmid Serotype Name 50459 AAV1 pAAV-hSyn-DIO-... Nuc-flox(mCherry)-EGFP 50457 AAV2 pAAV-hSyn-DIO-EGFP Recombinases Plasmid Serotype Name 87306...the entire collection! Plasmid Serotype Name 51502 AAV5 pCAG-FLEX-EGFP-WPRE 114471 AAV1, AAV5 pAAV-Ef1a-fDIO...inventory. Our new AAVs include: Optogenetics AAV Control AAV Biosensor AAV And more! Optogenetics Optogenetics...more efficient tools for light mediated neuronal control and we are expanding our viral service to make ...
  14. Zhang Lab CRISPR Page

    Type
    Collection
    ...tracrRNA: This plasmid contains three expression cassettes. To target a given site, the plasmid can be digested...activator with 2A GFP 61423 : Expresses the MS2-P65-HSF1 activator helper complex with 2A GFP 61424 : sgRNA...sgRNA cloning; has GFP-KASH for FACS sorting SaCas9 + single guide RNA: These plasmids contain two expression...guide acceptor: The PX552 plasmid (#60958) contains pAAV-U6::sgRNA(SapI)_hSyn-GFP-KASH-bGH (SpGuide acceptor...acceptor). This is a AAV plasmid for sgRNA cloning. GFP-KASH fusion facilitates FACS sorting of cells and...adenocarcinoma pathology. These plasmids as well as a backbone plasmid for cloning new targets are described...present within the mouse genome. This plasmid is used as a control for AAV-KPL. #60226 - AAV:ITR-U6-sgRNA...
  15. The Fluorescent Vegetables in Aptamer Soup

    Type
    Blog Post
    ...Browse fluorescent protein plasmids and resources See all Jaffrey lab plasmids ... cellular processes by transforming cells with plasmids encoding aptamer-tagged RNA and later introducing...aptamer downstream of a known promoter. Addgene’s Plasmids 101: Aptamer Fluorophores describes the enrichment...aptamers able to bind to a small molecule derivative of GFP called 3,5-difluoro-4-hydroxybenzylidene imidazolinone...metabolites, leading to conformational changes that control the expression of coding RNA. Spinach-based riboswitches...
  16. Overcoming the AAV Size Limitation for CRISPR Delivery

    Type
    Blog Post
    ...injury markers were not increased compared to a control AAV-GFP. Not only did the AAV-SaCas9-sgRNA constructs...capabilities of full-length SpCas9. This set of plasmids includes AAV-Cas9C-VPR for targeted gene activation...bacterial immune system cleaves bacteriophage and plasmid DNA. Nature 468:67–71 . https://doi.org/10.1038...Addgene.org Check out our CRISPR Guide Find CRISPR Plasmids ...
  17. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ...highlight a subset of the new plasmids in the repository through our hot plasmids articles. These brief articles...articles provide a synopsis of a plasmid or group of plasmids' functions and applications. We hope that... you to find and use the plasmids you need. You can find all the hot plasmids from 2017 below. With over...over 50,000 plasmids, we can't write posts for every great plasmid that comes into the repository, but...write about your plasmids in a future blog post. No time to read? Listen to our hot plasmids segment on the...editing for precise genome modification. Plasmid ID Plasmid Name Cas9 Variant Speacial Features 85169... to the Addgene blog to get all the latest hot plasmid updates!     Tol2 Gateway-compatiable toolbox...
  18. The Challenges of Cell Culture

    Type
    Blog Post
    ...Dangers of Using GFP for Protein Localization Resources on Addgene.org Find Plasmids for Mammalian Cells... laboratories to carry our independent quality control for a range of testing, from animal doping to forensics...
  19. Magnetic Control of Proteins: More than a Dream

    Type
    Blog Post
    ...resources on addgene.org Find Optogenetics Plasmids Find Biosensor Plasmids Visit the Fluorescent Protein Guide...Frank Hayward et al., 2024). They deposited their plasmid with Addgene, hoping to inspire others to explore... of a magnetoresponsive fluorescent protein. Controlling an optogenetic or fluorescent tool with magnets... 2016), and some previous attempts at magnetic control of biological systems (Wheeler et al., 2016; Duret...Lab is eager to hear from you. Find the MagLOV plasmid here!   References and resources References Duret...T., York, A. G., Ingaramo, M. (2024). Magnetic control of the brightness of fluorescent proteins. Zenodo...Güler, A. D. (2016). Genetically targeted magnetic control of the nervous system. Nature Neuroscience, 19(...
  20. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...Site-Specific Recombinases Cre Plasmids Dre Plasmids Flp Plasmids Other Recombinase Plasmids Recombinase-Dependent...Teaching an Old DOG New Tricks: Controlling Protein Activity with GFP Plasmids 101: FLEx Vectors Optimizing... the genome or control gene expression, and find plasmids for your experiments. Plasmid...Fluorescent Biosensors Chemogenetics Plasmid Collection Optogenetics Plasmid Collection Monosynaptic Neuronal...modify the genome or control gene expression or skip ahead to browse highlighted plasmids expressing Cre ,... vectors. Highlighted Plasmids Browse the tables below to find popular plasmids expressing your favorite...tamoxifen”, or “light”): Cre Recombinase Plasmids ID Plasmid Description Vector Type Promoter PI Additional...
Showing: 101 - 120 of 155 results