Skip to main content
Addgene
Showing: 101 - 120 of 265 results
  1. Sequencing Primers

    Type
    Guide
    ... TACCCATACGACGTCCCAGA HA tag, forward primer HA-R TCTGGGACGTCGTATGGGTA HA tag, reverse primer HAT GAGGAGCACGCTCATGCCCAC...(BD Biosciences) Histidine affinity tag, forward primer hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone...Myc GCATCAATGCAGAAGCTGATCTCA (BD Biosciences) Myc tag, forward primer Neo-F CGTTGGCTACCCGTGATATT 3' end...GGTGGTAATGCCATGTAATATG (Stratagene) S. cerevisiae GAL10 promoter, forward primer Gal4 N-term GAGTAGTAACAAAGGTCAA 3' end...in pRS vectors Pry1 CTTAGCATGTCCGTGGGGTTTGAAT PZ P-element, reverse primer pTrcHis Forward GAGGTATATATTAATGTATCG...GAGGTATATATTAATGTATCG (Invitrogen) 5' of MCS in pTrcHis vector, forward primer pTrcHis Reverse GATTTAATCTGTATCAGG (Invitrogen... primer T7 TAATACGACTCACTATAGGG T7 promoter, forward primer T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator...
  2. Neuronal labeling with Spaghetti Monster

    Type
    Blog Post
    ...strep-tag and, more recently, OLLAS (Escherichia coli OmpF linker and mouse langerin) and Sun Tag (Viswanathan...antibodies can have low affinity for these tags and even multimeric tags are frequently insufficient for detection...FP and epitope tags, researchers in Loren Looger’s lab have developed new molecular tags combining the ...antibody recognition of epitope tags. Thus they have created antigenic protein tags called “spaghetti monster...interest (POI), that facilitate immunohistochemistry (IHC) experiments with tag-specific antibodies. The most...Viswanathan, 2015). The principal advantage of epitope tags for IHC is the availability of reliable primary... are unavailable entirely. The other advantage is that these tags are small (8-12 amino acids) and neither...
  3. Hot Plasmids: Winter 2025

    Type
    Blog Post
    ...Twelvetrees Lab took advantage of the self-labeling tags SNAPf and CLIPf. These tags rely on synthetic dye...single- and double-tagged constructs (including "CLAP", combining an N-terminal CLIPf tag and a C-terminal...dicots Self-labeling tags for single-molecule biophysics Fast and responsive voltage indicator ONE-GO biosensors...2024.02.11.579803).  CLIP, CLAP, SNAP! Self-labeling tags for single-molecule biophysics By Mike Lacy In order...C-terminal SNAPf tag; see Figure 2), the authors developed a cost-effective expression and labeling approach ... The team deposited an array of constructs for tagging the kinesins KIF5A and KIF5B as well as backbones...backbones for generating other SNAPf-, CLIPf-, and CLAP-tagged proteins for mammalian cell expression. These plasmids...
  4. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...Roux lab has deposited HA tagged BioID2 for N-terminal fusions and Myc tagged BioID2 for C-terminal fusions...for an individual tagging event. Commonly used sequences, including fluorescent tags, a floxed Cbr-unc...proteins are tagged with Protein A-Renilla luciferase and the “prey” proteins are tagged with Firefly ...expression screen that can be used to generate His-tagged human kinase constructs that express well in ...blotting and immunohistochemistry, and are summarized in the table below:   ID Cv (Capsid) FLAG Tag Terminus...technology. To streamline CRISPR/Cas9-based genetic tag insertion in the C. elegans genome, Erik Jorgensen...119 selectable marker, and “connectors” that link tags to the targeted gene are supplied to the reaction...
  5. Single-cell tracking of lineage and identity with CellTag

    Type
    Blog Post
    ...the single-cell level with CellTag CellTagging is a lentiviral based tagging method that labels cells with...Each cell is labeled with 3-4 tags to increase the diversity of the CellTag library. The fixed region acts...library-specific identifier and allows cells to be tagged with different CellTag libraries at multiple timepoints during...inefficient. Cells were sequentially tagged with different CellTag libraries at three time points during...reprogramming outcomes. For example, cells with shared CellTagD13 tags often had similar gene expression pattern changes...expression patterns. The lab has also used CellTags for tagging two cell populations in a competitive transplant....    Find CellTag libraries here!  Applications of CellTag The Morris Lab developed CellTag to track the...
  6. Genetic Code Expansion

    Type
    Collection
    ...analogs Mammalian TAG Huiwang Ai 160041 pRaGE Pyl TAG GFP Y35TAG PylRS M. mazei Bacterial TAG Lital Alfonta...DiZHSeC Mammalian TAG P. Chen 92047 pCOTS-pyl-GFP(35TAG) PylRS M. mazei Cyanobacterial TAG Lital Alfonta ...Alfonta 160089 pPaGE Pyl TAG FliC T248TAG PylRS M. mazei Bacterial TAG Lital Alfonta 160377 pDule-Mb haloTyrRS...coli pBof Mammalian TAG Huiwang Ai 68292 SepOTSλ SepRS9 E. coli Sep Bacterial TAG Jesse Rinehart 71403...Bacterial TAG Dieter Söll 104069 pTECH-chAcK3RS(IPYE) AcK3RS Chimeric Nε-acetyl-L-lysine Bacterial TAG David...Bacterial TAG David Liu 104071 pTECH-MmAcK3RS(IPYE) AcK3RS M. mazei Nε-acetyl-L-lysine Bacterial TAG David...Bacterial TAG David Liu 104073 pTECH-MmPylRS(IPYE) PylRS M. mazei m-iodo-L-phenylalanine Bacterial TAG David...
  7. Structural Genomics Consortium Plasmids

    Type
    Collection
    ...EF199844 Hexahistidine tag, FLAG tag with TEV cleavage, KanR 26106 pNH-TrxT GU269914 Hexahistidine tag, thioredoxin...EF456736 Hexahistidine tag with TEV cleavage, AmpR 26093 pET15-MHL EF456738 Hexahistidine tag with TEV...pNIC-CH EF199843 Hexahistidine tag, AmpR 26103 pNIC28-Bsa4 EF198106 Hexahistidine tag with TEV cleavage...GU452710 Hexahistidine tag , Z-basic, TEV cleavage, AmpR 26108 pFB-LIC-Bse EF199842 Hexahistidine tag with... EF442785 Hexahistidine tag with Thrombin cleavage, KanR 26101 pET28GST-LIC EF456739 GST-tag and hexahistidine...hexahistidine tag with Thrombin cleavage, KanR 26096 pET28-MHL EF456735 Hexahistidine tag with TEV cleavage...pCW-LIC EF460848 No tag, double ptac promoter, AmpR 26099 pFBOH-LIC EF456740 Hexahistidine tag with Thrombin...
  8. Site Directed Mutagenesis by PCR

    Type
    Blog Post
    ... the mutagenesis reaction. Alternative approaches to site directed mutagenesis Point-mutagenesis is fairly...  Site-directed mutagenesis of Plasmids. A) Generation of mutagenized plasmids. PCR primers (green...Laursen from Cornell University. Site directed mutagenesis is a highly versatile technique that can be used...analysis of proteins (to perform alanine scanning mutagenesis or targeted substitution of key residues), and...relevant in this age of CRISPR; site-directed mutagenesis generally applies to plasmids, but may also facilitate...plasmid contains the template, site-directed mutagenesis can be used to mutate the PAM sequence (an NGG...Cas9 induced cleavage. Summary of Site Directed Mutagenesis In brief, point-mutations can be introduced to...
  9. RNA Interference in Plant Biology: New Tools for an Old Favorite

    Type
    Blog Post
    ...guest blogger Robert Orr! Robert Orr recently earned his Ph.D. in Biology and Biotechnology from Worcester...polarized cell growth in the lab of Luis Vidali. For his next adventure, he will join the lab of Darren Gilmour...tool requires careful balancing of the inherent advantages and limitations of any technique in the context...technologies, one might incorrectly relegate RNAi to history. The straightforwardness of RNAi is unmatched—unlike...cannot be used to investigate essential genes. Historically, gene silencing methods were thought to be afflicted...interest. Tools for RNAi Arguably the greatest advantage of RNAi is the straightforward nature of the technique—all...approaches and considerations present at the first stage of an RNAi-based investigation. Creation of the ...
  10. Hot Plasmids and Viral Preps - March 2021

    Type
    Blog Post
    ... well as additional useful tags, including 3xFLAG epitopes, TEV and BioTag, which can be used in protein... protein effectivity), and a fluorescent protein tag for visualization (Fig. 1b). While the probes target...ultimately leading to the degradation of the AID-tagged protein. To quantify protein degradation the Ward...44 amino acids auxin inducible degron sequence) tagged proteins. Degradation of your protein interest ...Gibson and Saptrap cloning systems to generate AID* tagged CRISPR knock-in repair constructs. These repair...repair constructs can be used to integrate the tagged AID* into genomic sites of interests via CRISPR techniques...a nucleus -> DNA compaction around histones -> Examples of histone-modifying enzymes and reader-effector...
  11. The Strength of Story Telling

    Type
    Blog Post
    ...under a lot of pressure recently which had affected his judgement. Eventually, we published the paper in ... your structure. Develop your protagonist In most cases, the protagonist will be you. Make sure to highlight...enjoy, remember, and listen to narratives — take advantage of that in your work The part of my job I most...
  12. Summer SciComm Series: Master of SciComm

    Type
    Blog Post
    ...Communication where he completed a master's degree in 2020, his research explores risk-taking behavior among collision...into a summer school course at the University of Otago’s Department of Science Communication the following... The Owheo building, home of the University of Otago's Science Communication Department The power ...Alex Gilbert is a PhD student at the University of Otago. Studying in the same Department of Science Communication...
  13. 9 Tips to Achieve Success in Academia

    Type
    Blog Post
    ...development, teaching, etc. Church also encourages his mentees to follow their passion. “There are many ...interviewed Addgene depositors who are at various stages in their careers to get advice on choosing a lab...
  14. Choosing Your Perfect Empty Backbone

    Type
    Blog Post
    ...epitope tag (6xHis or GST) to affinity purify the expressed protein with a specific resin (e.g. 6xHis containing...protein available – you can always add an epitope tag or a fusion protein. Mammalian vectors One of our...popular studies involve using a reporter vector to tag YGOI with lacZ and/or GFP (e.g. pPD80_08) and following...& Other Plasmid Protocols List of common epitope tags ...level expression? Finally, you can add bells and whistles to your construct. If you are planning to track...be a more robust expression system and has its advantages; however, remember that you will need accessory...containing pDEST-HisMBP). After purification the protein can be released from the resin and used for various...
  15. Antibody Guide

    Type
    Guide
    ...the sdAb, or by using a secondary against a tag, such as His, incorporated in the sdAb. sdAbs can have ...location. Includes: Immunofluorescence (IF) Immunohistochemistry (IHC) Immunocytochemistry (ICC) Cell Sorting...in these assays. This method is suitable for DNA:histone modifier interactions, which have strong binding...methods such as immunofluorescence (IF), immunohistochemistry (IHC), and immunocytochemistry (ICC) use... they only have one protein of interest. Immunohistochemistry (IHC) and immunocytochemistry (ICC) IF can... can refer to both immunohistochemistry and immunocytochemistry when fluorescent signaling molecules (...
  16. Viral Vectors 101: Voltage Indicators

    Type
    Blog Post
    ... Several adaptations of this method have been to tag, cage, uncage, and trap the chemical fluor with the...research tools for studying voltage within a cell are genetically encoded voltage indicators (GEVIs) and chemigenetic...Types of Voltage Indicators GEVIs can be divided up structurally into 2 main groups: voltage sensitive...earliest developed voltage sensor with a genetic component. The VSD components have historically come from a ...occurring voltage indicator. To give an example, a genetically encoded phosphatase (voltage sensing) hydrolyzes...form of fluorescence or voltage indicators.   Viral Vectors and Voltage Indicators As previously...previously mentioned, cellular voltage is measured at the cell membrane, and this voltage is particularly physiologically...
  17. Hot Plasmids - February 2022

    Type
    Blog Post
    ... small epitope tag (FLAG is eight amino acids, HA is nine), multiple repeats of the tag can recruit multiple...SNAP-tag, and HaloTag fusions, while the anti-HA frankenbodies include mEGFP, mCherry, and HaloTag. ...separately. The proteins, which are purified via histidine tags, are optimized for SDS-PAGE gels and can be...b) Schematic of anti-FLAG-FB-GFP binding to FLAG-tag H2B for nuclear localization. (c) Applications of...blotting, and more. Given the popularity of FLAG and HA tags, you may not even need to clone new constructs to...editing within a single expression cassette is advantageous to Cas9’s larger expression requirements (Figure...
  18. Plasmids 101: Secondary Nanobody Toolbox

    Type
    Blog Post
    ...column due to their N-terminal His14-bdNEDD8 tag. After several washes, this tag can be cleaved by the bdNEDP1...sacrifice and precludes genetic engineering of a tag or fusion with a reporter enzyme. For multicolor ...and decreases the distance between a fluorescent tag and the target antigen to about 2 nm, which can lead...antibody can be “labeled” by incubating it with a tagged nanobody. After this pre-incubation step, the primary...Label the Nanobodies: Purified nanobodies are then tagged with a fluorescent dye or HRP via maleimide-labeling...Control Protein Activity Learn more about protein tags Read about E. coli strains for protein expression... Structural Comparison Functional Comparison Advantages of Nanobodies How to Use the Nanobody Toolbox...
Showing: 101 - 120 of 265 results