We narrowed to 4 results for: his-tag

...prokaryotes. Common Epitope Tags Tag Amino Acid Sequence FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL...sequence. Epitope tags, on the other hand, are commonly used in molecular cloning to tag a gene within a...E GAA, GAG Glycine Gly G GGU, GGC, GGA, GGG Histidine His H CAU, CAC Isoleucine Ile I AUU, AUC, AUA Leucine...random incorporation of modified, fluorescently-tagged bases during in vitro DNA replication in addition...nucleotides. The four standard bases (dNTPs) are tagged with a different fluorophore so they can be distinguished...distinguished from one another. These tagged dNTPs also lack a binding site for the next nucleotide (denoted...because the ultimate goal is to have a fluorescently-tagged nucleotide at each position in the DNA sequence...

...the sdAb, or by using a secondary against a tag, such as His, incorporated in the sdAb. sdAbs can have ...location. Includes: Immunofluorescence (IF) Immunohistochemistry (IHC) Immunocytochemistry (ICC) Cell Sorting...in these assays. This method is suitable for DNA:histone modifier interactions, which have strong binding...methods such as immunofluorescence (IF), immunohistochemistry (IHC), and immunocytochemistry (ICC) use... they only have one protein of interest. Immunohistochemistry (IHC) and immunocytochemistry (ICC) IF can... can refer to both immunohistochemistry and immunocytochemistry when fluorescent signaling molecules (...

...TACCCATACGACGTCCCAGA HA tag Forward HA-R TCTGGGACGTCGTATGGGTA HA tag Reverse HAT GAGGAGCACGCTCATGCCCAC Histidine affinity...affinity tag Forward hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator Reverse hU6-F GGGAAACGCCTGGTATCTTT...promoter Forward Myc GCATCAATGCAGAAGCTGATCTCA Myc tag Forward Neo-F CGTTGGCTACCCGTGATATT 3' end of neomycin...' of MCS in pTrcHis vector Forward pTrcHis Reverse GATTTAATCTGTATCAGG 3' of MCS in pTrcHis vector, same...BGH-R TAGAAGGCACAGTCGAGG Bovine growth hormone terminator Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human...promoter Forward T7 TAATACGACTCACTATAGGG T7 promoter Forward T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator ...Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1 promoter Reverse BGH-R TAGAAGGCACAGTCGAGG Bovine...

...DNA. The system can use common tags, like 3xFLAG-tag, PA, and biotin tags, or an anti-Cas9 antibody. The...in mammalian cells include: SunTag system — co-expression of epitope-tagged dCas9 and antibody-activator...acid, turn a promoter on/off, or add small protein tags. Precise Modifications Using Homology Directed Repair...Plasmids: Double-Strand Break (Cut) , Endogenous Tagging CRISPR Base Editing To overcome low HDR efficiency...also be fused to the gRNA to recruit fluorescently-tagged RNA-binding proteins (RBPs). Multicolor CRISPR ...dCas9s (e.g. S. pyogenes dCas9 and S. aureus dCas9) tagged with different fluorescent proteins or by fusing...sequence specified by a particular gRNA. Epitope tag(s) are fused to dCas9 or gRNA for efficient purification...