Skip to main content
Addgene
Showing: 121 - 140 of 340 results

  1. CRISPR 101: Which Cas9 Do I Choose for My CRISPR Experiment?

    Type
    Blog Post
    ...repository) and make it easy to find your perfect match. Choosing a Cas9 for your knockout experiment Generating...resources on the Addgene website Find CRISPR Plasmids Catch up on your CRISPR background with our CRISPR Guide...

  3. Antibodies 101: Introduction to Immunofluorescence

    Type
    Blog Post
    ...trusted secondary antibodies on hand to mix and match with a larger collection of primary antibodies. ...suits your experiment (i.e. the spectral properties match your available imaging instruments and the spectral...

  4. Hot Biosensors 2022: Year-End Roundup

    Type
    Blog Post
    ...biosensor with a binding affinity that is better-matched to the potassium concentrations in cells than existing...lactate biosensors, and its affinity is better-matched to cellular concentrations of lactate. The microfluidic...

  5. A Control for All Seasons

    Type
    Blog Post
    ...animal the antibody was produced in or an isotype-matched control antibody. This control addresses situations...in preimmune serum ‌as well as with an isotype-matched control.      Figure 3: A preimmune serum...

  6. CRISPR 101: Cytosine Transversion Editors

    Type
    Blog Post
    ...excision repair (BER), the cellular process that catches mutated U’s in DNA and ideally converts them back...gRNA/sgRNA Guide RNA RNA used by Cas9 to locate a matching DNA sequence.   Target strand The DNA strand...

  7. Sequencing Primers

    Type
    Guide
    ...35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter, forward primer AC5 ACACAAAGCCGCTCCATCAG (Invitrogen...primer LacI-R GGCATACTCTGCGACATCGT 5' end of LacI, reverse primer LacZ-R GACAGTATCGGCCTCAGGAA 5' end of LacZ... pBluescriptKS TCGAGGTCGACGGTATC For pBluescript vector pBluescriptSK TCTAGAACTAGTGGATC For pBluescript...pBR322ori-F GGGAAACGCCTGGTATCTTT pBRS322 origin, forward primer pBRforBam CTTGGAGCCACTATCGAC In pBR322 ... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward... stem cell virus, forward primer pBABE 5' CTTTATCCAGCCCTCAC (Weinberg Lab) Psi packaging signal, 5' of... forward primer Full Primer List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1...

  9. Troubleshooting and Optimizing a Western Blot

    Type
    Blog Post
    ...even at 4 °C, so when in doubt, make up a fresh batch.  Antibodies We always recommend either using an...sure the sensitivity of your exposure solution matches the expected amount of protein in your samples....

  10. 22 Hot Plasmid Technologies from 2014

    Type
    Blog Post
    ....addgene.org/CRISPR/ to browse CRISPR plasmids, watch informational videos, download protocols, and more...ligation using SpyLigase Building off their SpyTag/SpyCatcher system for protein-peptide locking, Mark Howarth...

  11. CRISPR Guide

    Type
    Guide
    ...direction. The location of any potential mismatches matters. Mismatches between the target sequence in the ...target DNA. If the seed and target DNA sequences match, the gRNA will continue to anneal to the target ... seed sequence inhibit target cleavage, while mismatches toward the 5′ end distal to the PAM often permit...HDR) pathway. HDR relies on copying DNA from a matching template to accurately repair or fill in the missing...contains the desired edit as well as additional DNA matching the sequence immediately upstream and downstream...resulting heteroduplex is resolved by the cell’s mismatch repair system. Alternatively, the edited 3’ flap... sgRNA directs Cas9n to a nearby site, driving mismatch repair using the edited strand as a template PE4...

  12. Plan Your Experiment

    Type
    Guide
    ... when mismatches occur near the PAM sequence, so gRNAs with no homology or those with mismatches close...on-target cleavage. The gRNA target sequence needs to match the target locus, but it is also critical to ensure...ensure that the gRNA target sequence does NOT match additional sites within the genome. In a perfect world...at the same position in spite of being a perfect match for the target sequence. Many gRNA design programs...your desired edit, including but not limited to: Mismatch-cleavage assay (for NHEJ repaired DSBs): Provides...

  14. Antibodies 101 Series on TikTok

    Type
    Blog Post
    ...shared on our @addgene Instagram account, or you can watch the full animation on our YouTube channel.  More...
Showing: 121 - 140 of 340 results