...comprised of OCT4, SOX2, LIN28, NANOG, and a GFP reporter. Minicircles are removed from cells by dilution...started the field of iPSCs Find gene-specific plasmids (including reporters and RNAi) for:  NANOG  OCT4 ...reprogramming transgenes and the up-regulation of corresponding endogenous pluripotency genes. Retroviral...disrupt the expression of tumour suppressor genes and/or oncogenes, potentially leading to the presentation... Shao, L., & Wu, W. (2010). Gene-delivery systems for iPS cell generation. Expert opinion on biological...high is based on the reprogramming efficiencies reported in González et al. A percentage is not listed ...a single polycistronic vector or multiple single-gene vectors can be used to package reprogramming factors...

...aptamers able to bind to a small molecule derivative of GFP called 3,5-difluoro-4-hydroxybenzylidene imidazolinone...growth as RNA biology, we are looking forward to reports on the next additions to aptamer soup! References...If you’re been following Addgene on #souptwitter or if you just enjoy a warm meal on a winter day, you...molecule into the cell. The fluorescence that is generated allows for qualitative and quantitative measurement...placing the aptamer downstream of a known promoter. Addgene’s Plasmids 101: Aptamer Fluorophores describes the... we’ll take a deeper dive into the content of Addgene’s aptamer soup by exploring the development and ...and applications of fluorescent RNA aptamers in Addgene’s collection. Green fluorescent aptamers Spinach...

...remove genes flanked by either loxP or frt sites respectively, and empty vectors to express your gene of ...and puromycin resistance gene from the CMV promoter pCDH-CMV 72265 Express gene of interest from the CMV...pCDH-EF1 72266 Express gene of interest from the EF-1 promoter pCDH-CB 72267 Express gene of interest from ...promoter pCDH-EF1-copGFP-T2A-Puro 72263 Express copGFP and the puromycin resistance gene from the EF1 promoter...vectors you can find reporter plasmids to test whether or not you've efficiently generated infectious virus...the cloning capacity. pCDH-CB-IRES-copGFP-T2A-Puro 72299 Express gene of interest from the CB promoter ... 72484 Express gene of interest from a truncated EF-1 promoter pCDH-EF1-Luc2-P2A-copGFP 72485 Expresses...

...possible deletion strategies for genes and non-coding elements. For creating a gene knockout, two sgRNA located...evaluate the RNA, perform RT-qPCR for gene expression of the relevant gene 7,8 . To evaluate the protein, perform...genome editing tool that allows genetic perturbation of genes and genetic elements. Here we present a simple... as pX458 (Addgene plasmid ID 48138) or pX459 (Addgene plasmid ID 48139), which include GFP and puromycin...for efficient loss-of-function studies of genes and genetic elements in mammalian cell lines. Protocol...CRISPR/Cas9 construct (10 μg total). Add 0.5 μg of GFP expression construct. Electroporate cells with 250...transfection conditions for each cell line with a reporter construct to ensure robust plasmid delivery before...

...along with a reporter, such as a fluorescence gene or a resistance gene. These reporters allow you to easily...you could replace one of the reporter genes above with your gene or genes of interest. Some of the plasmids...the reporter gene). Addgene's collection offers a variety of plasmids to express two or more genes, some... that are expressing your gene, especially if you are studying a novel gene, is not always a straightforward... your gene of interest, scientists have instead developed novel methods to co-express your gene along ...express more than two genes at a time using IRES elements. Further, scientists have reported lower expression...multicistronic element and reporter cloned in. In these plasmids you would simply clone your gene of interest into...

...23849981 Qi GFP A. victoria GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria... cut S. pyogenes 25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981...cut S. pyogenes 26018130 Xue inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130...-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate S. pyogenes 25664691 Gersbach...26018130 Xue inverted GFP A. victoria GTTGATCCATAACTTCGTAT 66584 cut S. pyogenes 26018130 Xue IRF1 H. sapiens...accomplish. Validated gRNA Sequence Datatable Target Gene Target Species Target Sequence Plasmid ID Application...

...may be the hot new way to manipulate gene expression, but other gene manipulation systems remain valuable...important ways to spatially and temporally control gene expression, especially in in vivo models, and new...-2.1 construct can express one of four colors (n-GFP, RFP, YFP or M-CFP.) The construct contains two tandem...ten colors (see table to the right); in various reports, Sanes and Lichtman have observed from 90-160 distinct...mOrange2, jellyfish EGFP, and sea anemone mKate2.) They then successfully generated custom antibodies to...-2. The general structure of Brainbow-1.0 is retained in Brainbow-3.0, but with mOrange2, EGFP and mKate2...at least six generations. In addition to the neuronal pThy1-Brainbow constructs, Addgene also has two ...

...plasmids for the EGFP Reporter Gene Guide RNA expression plasmids for endogenous human genes Guide RNA expression...these vectors for efficiently modifying endogenous genes in zebrafish (Hwang and Fu et al., Nat Biotechnol...expression plasmids for endogenous zebrafish genes...

...Figure 1). All viral genes are removed and replaced by a single (non-viral) reporter gene (e.g. firefly luciferase...transcribe the reporter gene (e.g. firefly luciferase). The polymerase recognizes the gene start signal ...transcription of the reporter gene. The polymerase will elongate the mRNA until it reaches the gene end signal,...luciferase or eGFP) flanked by the EBOV-specific gene start and gene end sequences. Thus, the minigenome...replication and viral gene transcription (6). The EBOV genome contains seven viral genes, each flanked by ...sequence (gene start) and a transcription termination/polyadenylation signal sequence (gene end). A minigenome...necessary to direct minigenome replication and reporter gene transcription by the EBOV polymerase (reviewed...

...Endogenous Zebrafish Genes TALENs for Endogenous Human Genes TALENs for the EGFP Reporter Gene Additional Plasmids...transcriptional activator target sites and then generates individual user-friendly graphical roadmaps for...

...protein, permeabilized cells  Cy5NTAc 32 25-45 GFP (fluorescein is similar)   Lumio Red Tc: CCPGCC 48...protein kinase dynamics in living cells with FRET reporters." Methods 40.3 (2006): 279-286. PubMed PMID: 16908183...in setting up a FRET-based assay or screen (the Addgene blog has an excellent primer on FRET and how to...Fluorescent proteins (FPs) are the gold standard for genetically-encoded FRET donors (Fig. 1). Scores of FP variants...presented (Fig. 1) which can be carried out using Addgene plasmids. His-tag labeling reagents You may already...Gradia Lab has deposited a gateway vector with Addgene, where you can insert your protein of interest,...PubMed Central PMCID: PMC4380784. Resources on the Addgene Blog Get Tips for Using FRET in Your Experiments...

...another marker, such as GFP. A researcher can use FACS to sort cells expressing GFP and later expand these...fluorescent fusions or reporters. Browse lentivirus plasmids available from Addgene. 2nd Generation The graphic ...Available online: Genetic Organization and Genetic & Structural Features . In vivo gene delivery and stable...transfer plasmid. 2nd generation lentiviral plasmids utilize the viral LTR promoter for gene expression, whereas... rev, and tat genes all from a single packaging plasmid such as psPAX2 . 3rd generation packaging systems...packaging plasmid encoding the Gag, Pol, Rev, and Tat genes. The transfer plasmid contains the viral LTRs and...pictured). Unless an internal promoter is provided, gene expression is driven by the 5'LTR, which is a weak...

...other labs have reproduced their EGFP findings since the initial report in 2023.)     Figure 1:...Andrew and Maria were encouraged by previous reports that described magnetic responses of cryptochrome ...magnetic responses: EGFP, mScarlet, and AsLOV2. After several rounds of semi-random mutagenesis and screening.../nn.4265.  Additional resources on addgene.org Find Optogenetics Plasmids Find Biosensor Plasmids Visit... al., 2024). They deposited their plasmid with Addgene, hoping to inspire others to explore the phenomenon...Although a wide range of fluorescent proteins and optogenetic tools exist, humans (like many organisms) are...magnetoresponsive fluorescent protein. Controlling an optogenetic or fluorescent tool with magnets would enable...

...a gRNA designed to target a mutated gene. In a Scientific Reports paper introducing the delivery method...been used for many years for in vivo delivery and gene therapy and represent one of the most studied viruses...CRISPR-Cas. Figure 1: Schematic of targeted gene knock-out (left) and targeted DNA knock-in (right...binds to target DNA. In the final step of targeted gene knock-out (left), a fragment is deleted from two... This capacity is large enough to carry the Cas9 gene and a gRNA expression cassette in one single viral...Joining (NHEJ) DNA repair mechanism to knock out genes as a result of an insertion, a deletion or a frameshift...method in 2014, Manuel Goncalves lab report that AdV-mediated transduction of gRNA:Cas9 ribonucleoprotein...

...services collection or check out Addgene's Data Hub to see viral vector reports from other users. And don't...promoter. Use this for doxycycline inducible (tet-off) gene expression! We've also added AAV1 and AAV5 preparations...variants of a new optogenetic tool called PdCO, deposited by the Yizhar lab. Addgene is now offering AAV1... pAAV_hSyn-SIO-stChrimsonR-EGFP-P2A-PdCO-miniWPRE AAV1, AAV5 Optogenetics Yizhar New viral service with...AAV1, AAV5 Optogenetics Yizhar New viral service with multiple serotypes pAAV_hSyn-PdCO-EGFP-WPRE AAV1... Brian O'Neill.  More resources on the Addgene blog Addgene's Data Hub What is a Virus (and a Viral Vector...What's new in Addgene's ready-to-use viral vectors repository? Quite a bit! In this post, we'll share...

...measurable through an epitope tag such as FLAG/His/GFP. Fluorescent protein tags, which correlate closely...procedure and application to the major ALS/FTD disease gene C9ORF72. eLife, 8, e48363. https://doi.org/10.7554... specific detection of human TRPA1. Scientific Reports, 9(1), 18500. https://doi.org/10.1038/s41598-019...101: Validation Resources on addgene.org Addgene's Antibody Guide Addgene's Antibody Protocols... outlined below. Knockout cell line approach Genetic knockout-based validation can conclusively prove...you are working with cells that are amenable to genetic knockout, this represents a very robust approach...to start with a screening procedure in easily genetically modified cell types (top). The specific approach...

...services collection or check out Addgene's Data Hub to view viral vector reports from other users. And don't...AAV9 Optogenetics Adesnik New viral vector pAAV-nEF-Con/Foff DREADD Gi-mCherry AAV8 Chemogenetics Deisseroth... pENN.AAV.EF1a.eGFP.WPRE.rBG AAV PHP.eB Controls Wilson New serotype pAAV-CaMKIIa-EGFP AAV PHP.eB Controls...latest in Addgene's viral vectors services and resources!   More resources on the Addgene blog Addgene's...What's new in Addgene's ready-to-use viral vectors repository? Quite a bit! In this post, we'll share...Table 1: New ready-to-use viral vectors in the Addgene repository  Name Serotype Category Depositor...Deisseroth New viral vector pAAV.CMV.PI.EGFP.WPRE.bGH  AAV PHP.eB Controls Wilson New viral vector ...

... editing multiple genes at once; using dual nickases to generate a knockout or gene edit; or using Cas9...the targeted gene. The ideal result is a loss-of-function mutation within the targeted gene. However, the...eliminate target gene function. It has also been used extensively to screen for novel genes that regulate... activate, or repress genes. Each library typically contains ∼3–6 gRNAs per gene to ensure modification...repress, visualize, and isolate genes. Activation or Repression of Target Genes Figure 9: Overview of CRISPRi...highest levels of single-gene activation (Figure 9D) In bacteria, activating gene expression is more difficult... of effective gene activators when fused with dCas9. Recently, synthetic CRISPR-Cas gene activators have...

...elements. These plasmids contain a reporter gene (for example, luciferase or GFP) that offers a read-out of the...bacterial populations, an antibiotic resistance gene (i.e., a gene whose product confers resistance to ampicillin...transcription. Gene Knock-down Plasmids - Used for reducing the expression of an endogenous gene. This is frequently...check out Addgene’s CRISPR guide . Reporter Plasmids - Used for studying the function of genetic elements...chromosomes down to study their genes, marking the birth of molecular genetics. Today, scientists can easily...easily study and manipulate genes and other genetic elements using specifically engineered plasmids, commonly...when a gene is inserted within the MCS, its expression will be driven by the promoter. As a general rule...

...for doing gene targeting, reporter generation, controllable gene knockouts, and inducible gene inactivation...Alec Kimmelman targets mouse metabolic genes with ~6 gRNAs per gene.  CRISPR-Act3.0, developed by Yiping... Shirley Liu's lab targets all mouse genes with 10 gRNAs per gene. The guides are optimized to maximize... to develop CRISPR-based approaches for studying gene function in these systems. As a part of this effort...Yiping Qi's lab, allows simultaneous gene activation in plants.  FnCas12a, unlike other Cas12a nucleases identified...opportunities for investigating genetic mechanisms related to morphogenesis, cell fate specification, and...Lab have compiled a new toolkit for performing genetics studies in organoids. The Organoid EasyTag System...