Skip to main content

We narrowed to 151 results for: GFP reporter gene

Showing: 121 - 140 of 151 results
  1. Validated gRNA Sequences

    Type
    Collection
    ...23849981 Qi GFP A. victoria GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria... cut S. pyogenes 25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981...cut S. pyogenes 26018130 Xue inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130...-Basic-8x-gRNA-eGFP reporter synthetic AAAGGTCGAGAAACTGCAAA 60719 activate S. pyogenes 25664691 Gersbach...26018130 Xue inverted GFP A. victoria GTTGATCCATAACTTCGTAT 66584 cut S. pyogenes 26018130 Xue IRF1 H. sapiens...accomplish. Validated gRNA Sequence Datatable Target Gene Target Species Target Sequence Plasmid ID Application...
  2. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    ...Utilization During Gene Targeting with Zinc-Finger Nucleases. G3 Genes Genomes Genetics, 3(4), 657–664. ...experiment, consider co-transfecting with GFP. This allows you to sort for GFP-positive cells and to enrich for...Jaenisch, R. (2013). One-Step generation of mice carrying mutations in multiple genes by CRISPR/CAS-Mediated ... & Jaenisch, R. (2013). One-Step generation of mice carrying reporter and conditional alleles by CRISPR...example, choosing target sites that span the knock-in gene. For making mutations, one good way is to mutate...be okay if you are introducing a selection marker gene. The homology arms should be no more than 100 bp...for my genomic PCR, but couldn't amplify the EMX1 gene using same primer you used in the Science paper ...
  3. Evolution of Brainbow: Using Cre-lox for Multicolor Labeling of Neurons

    Type
    Blog Post
    ...may be the hot new way to manipulate gene expression, but other gene manipulation systems remain valuable...important ways to spatially and temporally control gene expression, especially in in vivo models, and new...-2.1 construct can express one of four colors (n-GFP, RFP, YFP or M-CFP.) The construct contains two tandem...ten colors (see table to the right); in various reports, Sanes and Lichtman have observed from 90-160 distinct...mOrange2, jellyfish EGFP, and sea anemone mKate2.) They then successfully generated custom antibodies to...-2. The general structure of Brainbow-1.0 is retained in Brainbow-3.0, but with mOrange2, EGFP and mKate2...at least six generations. In addition to the neuronal pThy1-Brainbow constructs, Addgene also has two ...
  4. Plasmids 101: Multicistronic Vectors

    Type
    Blog Post
    ...along with a reporter, such as a fluorescence gene or a resistance gene. These reporters allow you to easily...you could replace one of the reporter genes above with your gene or genes of interest. Some of the plasmids...the reporter gene). Addgene's collection offers a variety of plasmids to express two or more genes, some... that are expressing your gene, especially if you are studying a novel gene, is not always a straightforward... your gene of interest, scientists have instead developed novel methods to co-express your gene along ...express more than two genes at a time using IRES elements. Further, scientists have reported lower expression...multicistronic element and reporter cloned in. In these plasmids you would simply clone your gene of interest into...
  5. Zebrafish Plasmid Collection

    Type
    Collection
    ...zebrafish gene of interest? Search Addgene's collection for plasmids that contain a zebrafish gene or sequence...control of gene expression in zebrafish using red light. LipoGlo - Steven Farber Lab. A reporter system that...zebrafish-specific gene expression database that provides information about when genes are active in developing...developing embryos. zfRegeneration - A database for gene expression profiling during regeneration. Seurat - R ...-type specific conditional gene inactivation - Jeffrey Essner Lab GeneWeld Vectors for Targeted Integration...ranging from optogenetics to tools for studying diseases, are listed below: Lipid droplet reporters - Richard... finger nucleases, TALENS, and CRISPR/Cas9-based gene editing make the zebrafish a stalwart research model...
  6. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ... Depositor Collections Gene Vector Core Viral Vectors Gene Vector Core Viral...remove genes flanked by either loxP or FRT sites respectively, and empty vectors to express your gene of ...and puromycin resistance gene from the CMV promoter pCDH-CMV 72265 Express gene of interest from the CMV...pCDH-EF1 72266 Express gene of interest from the EF-1 promoter pCDH-CB 72267 Express gene of interest from ...promoter pCDH-EF1-copGFP-T2A-Puro 72263 Express copGFP and the puromycin resistance gene from the EF1 promoter...vectors you can find reporter plasmids to test whether or not you've efficiently generated infectious virus...the cloning capacity. pCDH-CB-IRES-copGFP-T2A-Puro 72299 Express gene of interest from the CB promoter ...
  7. Fluorescent Proteins: FRET

    Type
    Collection
    ...single-nanometer scale, scientists can use FRET to report on protein binding or conformational changes. Organic...your experiment, be sure to refer to published reports and include appropriate controls to help interpret...sREACh-C1 , mGFP-10-sREACh-N3 EGFP ShadowY** 488 0.6 531** 136,000 0.01 6.1 4.5 mEGFP-N1 , CMV-ShadowY , EGFP-ShadowY...(λ) Plasmids mTagBFP sfGFP 399 0.64 510 83,000 0.65 4.6 2.6 mTagBFP2-pBAD , sfGFP-pBAD ECFP EYFP 434 0.41...mTFP1-N1 , mCitrine-pBAD EGFP mCherry 488 0.60 610 72,000 0.22 5.3 1.9 mEGFP-N1 , mCherry2-N1 , pcDNA3.1...sReach-mTurquoise2 EGFP sREACh** (super-REACh, aka Nữ) 488 0.60 531** 115,000 0.07 6.0 4.1 mEGFP-N1 , sREACh-...Fixed Cells Additional Resources at Addgene Learn more on the Addgene Blog: Introduction to FRET and Tips...
  8. Minigenomes - a Safe Way to Study Dangerous Viruses Like the Ebola Virus

    Type
    Blog Post
    ...Figure 1). All viral genes are removed and replaced by a single (non-viral) reporter gene (e.g. firefly luciferase...transcribe the reporter gene (e.g. firefly luciferase). The polymerase recognizes the gene start signal ...transcription of the reporter gene. The polymerase will elongate the mRNA until it reaches the gene end signal,...luciferase or eGFP) flanked by the EBOV-specific gene start and gene end sequences. Thus, the minigenome...replication and viral gene transcription (6). The EBOV genome contains seven viral genes, each flanked by ...sequence (gene start) and a transcription termination/polyadenylation signal sequence (gene end). A minigenome...necessary to direct minigenome replication and reporter gene transcription by the EBOV polymerase (reviewed...
  9. Hot Plasmids: Summer 2025

    Type
    Blog Post
    ...recombinase payload activates a floxed reporter gene (genetically encoded or delivered separately). ...Libraries are available with T-Sapphire, EGFP, or mScarlet reporters, so you can choose a color compatible...plasmids from Addgene By Meghan Rego Attention AAV users: in an effort to expand your gene delivery toolkit...broad tissue tropism for gene therapy and ex vivo cell engineering applications and is especially well-...and AAV11 tropism and applications. A) AAV6 is reported to have broad tissue tropism, including skeletal...hematopoietic cells, and immune cells. B) AAV11 is reported to target skeletal muscle, kidney, spleen, lung...editing LARRYv2 pooled libraries for cell barcoding Addgene’s own AAV6 and AAV11 packaging plasmids Mapping ...
  10. Special Delivery: Fluorophore Targeting for FRET Studies

    Type
    Blog Post
    ...protein, permeabilized cells  Cy5NTAc 32 25-45 GFP (fluorescein is similar)   Lumio Red Tc: CCPGCC 48...protein kinase dynamics in living cells with FRET reporters." Methods 40.3 (2006): 279-286. PubMed PMID: 16908183...in setting up a FRET-based assay or screen (the Addgene blog has an excellent primer on FRET and how to...Fluorescent proteins (FPs) are the gold standard for genetically-encoded FRET donors (Fig. 1). Scores of FP variants...presented (Fig. 1) which can be carried out using Addgene plasmids. His-tag labeling reagents You may already...Gradia Lab has deposited a gateway vector with Addgene, where you can insert your protein of interest,...PubMed Central PMCID: PMC4380784. Resources on the Addgene Blog Get Tips for Using FRET in Your Experiments...
  11. TALEN Engineering

    Type
    Collection
    ...Endogenous Zebrafish Genes TALENs for Endogenous Human Genes TALENs for the EGFP Reporter Gene Additional Plasmids...transcriptional activator target sites and then generates individual user-friendly graphical roadmaps for...
  12. Magnetic Control of Proteins: More than a Dream

    Type
    Blog Post
    ...other labs have reproduced their EGFP findings since the initial report in 2023.)     Figure 1:...Andrew and Maria were encouraged by previous reports that described magnetic responses of cryptochrome ...magnetic responses: EGFP, mScarlet, and AsLOV2. After several rounds of semi-random mutagenesis and screening.../nn.4265.  Additional resources on addgene.org Find Optogenetics Plasmids Find Biosensor Plasmids Visit... al., 2024). They deposited their plasmid with Addgene, hoping to inspire others to explore the phenomenon...Although a wide range of fluorescent proteins and optogenetic tools exist, humans (like many organisms) are...magnetoresponsive fluorescent protein. Controlling an optogenetic or fluorescent tool with magnets would enable...
  13. Adenoviral Delivery of CRISPR/Cas9 Aims to Expand Genome Editing to Primary Cells

    Type
    Blog Post
    ...a gRNA designed to target a mutated gene. In a Scientific Reports paper introducing the delivery method...been used for many years for in vivo delivery and gene therapy and represent one of the most studied viruses...CRISPR-Cas. Figure 1: Schematic of targeted gene knock-out (left) and targeted DNA knock-in (right...binds to target DNA. In the final step of targeted gene knock-out (left), a fragment is deleted from two... This capacity is large enough to carry the Cas9 gene and a gRNA expression cassette in one single viral...Joining (NHEJ) DNA repair mechanism to knock out genes as a result of an insertion, a deletion or a frameshift...method in 2014, Manuel Goncalves lab report that AdV-mediated transduction of gRNA:Cas9 ribonucleoprotein...
  14. Antibody Validation for Flow Cytometry

    Type
    Blog Post
    ...measurable through an epitope tag such as FLAG/His/GFP. Fluorescent protein tags, which correlate closely...procedure and application to the major ALS/FTD disease gene C9ORF72. eLife, 8, e48363. https://doi.org/10.7554... specific detection of human TRPA1. Scientific Reports, 9(1), 18500. https://doi.org/10.1038/s41598-019...101: Validation Resources on addgene.org Addgene's Antibody Guide Addgene's Antibody Protocols... outlined below. Knockout cell line approach Genetic knockout-based validation can conclusively prove...you are working with cells that are amenable to genetic knockout, this represents a very robust approach...to start with a screening procedure in easily genetically modified cell types (top). The specific approach...
  15. New Viral Vectors - Summer 2024

    Type
    Blog Post
    ...services collection or check out Addgene's Data Hub to see viral vector reports from other users. And don't...promoter. Use this for doxycycline inducible (tet-off) gene expression! We've also added AAV1 and AAV5 preparations...variants of a new optogenetic tool called PdCO, deposited by the Yizhar lab. Addgene is now offering AAV1... pAAV_hSyn-SIO-stChrimsonR-EGFP-P2A-PdCO-miniWPRE AAV1, AAV5 Optogenetics Yizhar New viral service with...AAV1, AAV5 Optogenetics Yizhar New viral service with multiple serotypes pAAV_hSyn-PdCO-EGFP-WPRE AAV1... Brian O'Neill.  More resources on the Addgene blog Addgene's Data Hub What is a Virus (and a Viral Vector...What's new in Addgene's ready-to-use viral vectors repository? Quite a bit! In this post, we'll share...
  16. New Viral Vectors - March 2024

    Type
    Blog Post
    ...services collection or check out Addgene's Data Hub to view viral vector reports from other users. And don't...AAV9 Optogenetics Adesnik New viral vector pAAV-nEF-Con/Foff DREADD Gi-mCherry AAV8 Chemogenetics Deisseroth... pENN.AAV.EF1a.eGFP.WPRE.rBG AAV PHP.eB Controls Wilson New serotype pAAV-CaMKIIa-EGFP AAV PHP.eB Controls...latest in Addgene's viral vectors services and resources!   More resources on the Addgene blog Addgene's...What's new in Addgene's ready-to-use viral vectors repository? Quite a bit! In this post, we'll share...Table 1: New ready-to-use viral vectors in the Addgene repository  Name Serotype Category Depositor...Deisseroth New viral vector pAAV.CMV.PI.EGFP.WPRE.bGH  AAV PHP.eB Controls Wilson New viral vector ...
  17. Adenovirus Guide

    Type
    Guide
    ... contains an IRES-GFP construct that enables co-expression of GFP with the transgene of interest. With...provide a large transgene packaging capacity. Large protein-coding genes and complex gene expression cassettes...(2017). Adenovirus-mediated gene delivery: potential applications for gene and cell-based therapies in..., subsequent generations of rAdV vectors have been developed where more adenoviral genes have been removed...containing the adenoviral genes necessary for viral production. In AdEasy™, the transgene of interest is cloned...containing the transgene of interest, and the adenoviral plasmid containing the adenoviral genes necessary ...second and third-generation vectors. This capacity is large enough to carry the Cas9 gene and a gRNA expression...
  18. Hot Plasmids and Viral Preps - July 2021

    Type
    Blog Post
    ...for doing gene targeting, reporter generation, controllable gene knockouts, and inducible gene inactivation...Alec Kimmelman targets mouse metabolic genes with ~6 gRNAs per gene.  CRISPR-Act3.0, developed by Yiping... Shirley Liu's lab targets all mouse genes with 10 gRNAs per gene. The guides are optimized to maximize... to develop CRISPR-based approaches for studying gene function in these systems. As a part of this effort...Yiping Qi's lab, allows simultaneous gene activation in plants.  FnCas12a, unlike other Cas12a nucleases identified...opportunities for investigating genetic mechanisms related to morphogenesis, cell fate specification, and...Lab have compiled a new toolkit for performing genetics studies in organoids. The Organoid EasyTag System...
  19. CRISPR Guide

    Type
    Collection
    ... editing multiple genes at once; using dual nickases to generate a knockout or gene edit; or using Cas9...the targeted gene. The ideal result is a loss-of-function mutation within the targeted gene. However, the...eliminate target gene function. It has also been used extensively to screen for novel genes that regulate... activate, or repress genes. Each library typically contains ∼3–6 gRNAs per gene to ensure modification...repress, visualize, and isolate genes. Activation or Repression of Target Genes Targeting dCas9 to transcription...single-gene activation (Figure 9D) Figure 9: Overview of CRISPRi/a. In bacteria, activating gene expression... of effective gene activators when fused with dCas9. Recently, synthetic CRISPR-Cas gene activators have...
  20. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...the necessary packaging genes, while lentiviruses also contain accessory genes specific to each virus ...common packaging genes gag , pol , and env . The LTRs flank all of these required genes, and anything in...— contains packaging genes gag and pol Envelope plasmid — contains packaging gene env ; usually VSV-G ... envelope gene, a process called pseudotyping. VSV-G is by far the most common envelope gene, as it has...commonly used in gene therapy applications to more specifically direct delivery of gene therapies. Common... type of selectable marker. Fluorescent reporters, such as GFP, are another common selection marker. Instead...gamma-retroviral vectors. Gene Therapy Gamma-retroviral vectors are a popular choice in gene therapy applications...
Showing: 121 - 140 of 151 results