Skip to main content
Addgene

We narrowed to 379 results for: Lor;

Showing: 121 - 140 of 379 results
  1. Reaching out to China: Canton Nucleic Acids Forum (CNAF) 2015

    Type
    Blog Post
    ...some cases I couldn’t tell if the bags contained flora or fauna. I tried to find out what certain ingredients...and more are being reported. Zhou Songyang from Baylor College of Medicine and Sun Yat-sen University ...cas9 inducible knock-out system. His lab is also exploring the use of cas9 proteins from different species...
  2. Quick Guide to Working with Drosophila Part 1: Getting Started with Flies

    Type
    Blog Post
    ...the end tip of their abdomens, males have black coloration whereas females do not. Also, males have sex ...first emerge, their bodies will be very light in coloration and can look very plump. On the side of their...research, you’ll find more resources that may be more tailored to your field of study. 5 great resources to help...
  3. Fluorescent Proteins 101: Visualizing Subcellular Structures & Organelles

    Type
    Blog Post
    ...inside a cell with the images from the Allen Cell Explorer (1). When studying the function of a protein or...the human eye and are indifferent to subjective color intensity perception. Open source image analysis...FP you should use and how to select FPs for muli-color imaging. Furthermore, one must bear in mind that...
  4. Plasmids 101: Optimizing Plasmid Yields

    Type
    Blog Post
    ...use a reagent like Qiagen’s LyseBlue, which uses color to show you if lysis is incomplete. Protein expression...e.g. p15A, ColE1) can be increased by adding chloramphenicol to the culture medium. Improve the culture ...often require a longer growth time. Note: Julian Taylor-Parker contributed to the writing of this post....
  5. Interview: Nicola Patron on Plant Synthetic Biology, MoClo, and More

    Type
    Blog Post
    ...on gene transfer, from transgenes to plants, chloroplast to the nucleus, or pathogens to their hosts. ...in plants because of the auto-fluorescence of chlorophyll, so we looked at newer fluorescent proteins that...gotten some tools back from Addgene recently to explore their use in plants, including FRET tools, double...
  6. Deciphering the Mysteries of Behavior with Viral Vectors

    Type
    Blog Post
    ...involved. For example, an animal moving around to explore the environment has a different motivation (and... illuminated ones (risky). They also prefer to explore novel environments by initially moving along a ...risky bright place, driven by their motivation to explore novel environments, rather than being inhibited...
  7. AAV Titers: Where Do They Come From And What Do They Mean?

    Type
    Blog Post
    ... be more precise and more repeatable than qPCR (Taylor et al., 2017). However, because purified AAV preps...components, ddPCR may not be an improvement over qPCR (Taylor et al., 2017). What do Addgene AAV titers mean...: 20486768. PubMed Central PMCID: PMC2957240. 5.Taylor, Sean C., Genevieve Laperriere, and Hugo Germain...
  8. Transferable Skills Guide: Career Planning Resources

    Type
    Blog Post
    ...month, giving you a plethora of opportunities to explore! Again, attending one of these fairs is a great... know who is going to be there, so that you can tailor your CV accordingly. Make it stand out with key...graduate schools will even pay for you to attend!), exploring a job fair, and utilizing your local career development...
  9. Harnessing Bacterial Toxins for Allelic Exchange

    Type
    Blog Post
    ...exchange vector. This vector contains sacB, an chloramphenicol resistance cassette, and the R6K origin of ...products. To allow manipulation of naturally chloramphenicol-resistant strains, we have also included versions...exchange system, he is so excited to use it to explore how hospital-associated Gram-negative bacteria ...
  10. Antibodies 101: Introduction to Immunofluorescence

    Type
    Blog Post
    ...targets with different colors. Multiplex immunofluorescence Speaking of different colors, having a palette ...secondary antibodies in a few different species and colors makes it easy to perform multiplexed IF. By using...
  11. Antibodies 101: Beyond Surface Labeling

    Type
    Blog Post
    ...limited selection of fluorophores. If the available colors are already reserved for other markers in your ... all cells positively labeled with the selected color will not be CD8+ T cells and we can simply “dump...undesired cell populations. Dump gating uses the same color for different markers, making it easy to gate on...
  12. Treating Muscular Dystrophy with CRISPR Gene Editing

    Type
    Blog Post
    ...with many challenges, researchers have begun to explore genome editing approaches for exon skipping. Addgene...diseases will require HDR-mediated precision editing tailored to smaller patient populations. To bring DMD CRISPR... Cas9s such as eSpCas9 and SpCas9-HF should be explored to reduce off-target editing. Short-term CRISPR...
  13. Finding Your Perfect Job After University

    Type
    Blog Post
    ...rural Africa Once this position ended, I wanted to explore another area which I was really passionate about...returning from Ghana at the beginning of 2010, I explored options for going into parasitology but another... for young scientists and PhD students to also explore a range of alternative careers outside of acidemia...
  14. Validated gRNA Sequences

    Type
    Collection
    ...cut S. pyogenes 23287722 Church actII-orf4 S. coelicolor ATTACCAGGGACCGGAGTTC 62552 cut S. pyogenes 25739462...
  15. Antibodies 101: Flow Cytometry

    Type
    Blog Post
    ...cytometry experiment uses 2 or 3 different fluorescent colors each measuring a different target. Flow cytometers...versatile and some can accommodate up to 30 different colors. This lends flow cytometry particularly well to...causing dead cells to fluoresce.  When running a multicolor flow cytometry experiment, users must also prepare...
  16. With an Eye Towards the Future, We Look Back at the March for Science

    Type
    Blog Post
    ...is a PhD trained scientist at the University of Colorado, Anschutz Medical Campus.  He studies viruses ...currently a postdoctoral fellow at the University of Colorado Anschutz Medical Campus in Aurora, CO where she.... Erin is also the President of Project Bridge Colorado, an advocacy initiative that seeks to bridge the...
  17. A Primer on Optogenetics: Introduction and Opsin Delivery

    Type
    Blog Post
    ...an action potential. Halorhodopsins (HR) are green/yellow-light sensitive chloride ion pumps, activation...activation of which results in efflux of chloride ions, subsequent hyperpolarization, and inhibition of action...
  18. A Needle in a Base-Stack: Cas9 Structural Biology

    Type
    Blog Post
    ...Cas9 in the apo state (PDB ID 4CMP) with domains colored as in Figure 1. HNH, red; RuvC, orange; CTD, yellow...mismatches between base pairs 18 and 20.   Pro tip! The Taylor lab mutated the residues in this loop to produce... L., Jung, K., McCool, R. S., Johnson, K. A., & Taylor, D. W. (2022). Structural basis for mismatch surveillance...
Showing: 121 - 140 of 379 results