We narrowed to 846 results for: Tat
-
TypeCollection...spectrum of single-nucleotide variants (somatic hypermutation) in a wider editing window, and are thus well...
-
Synthetic Biology - Overview
TypeCollection...leading synthetic biologists around the world to facilitate the sharing of parts and information. Addgene... -
AAV for Neuronal Tracing
TypeCollection...infect any neighboring cells. Thus, through complementation, G-deleted rabies virus can spread to monosynaptically... -
Adenovirus Plasmids
TypeCollection...modular inserts for seamless assembly of multiple mutations, alterations, or transgene insertions into single... -
AAV Molecular Tools
TypeCollection... microtubule-associated protein tau with P301L mutation 1 Ikezu Don’t See What You’re Looking For? Our... -
Viral Vector Guides and Plasmids
TypeCollection...replication-incompetent. Specific genes have been mutated or deleted to prevent uncontrolled viral replication... -
Distribution to Industry
TypeCollection...Library name Type PI Description HR700_TP53 Exon Mutation Libraries CRISPR Thorsten Stiewe Use these donor... -
Microbiology Resources
TypeCollection...solanacearum species complex (Rssc) gene knockout and complementation constructs - Lahaye Lab Vaccinia virus ORF ... -
Worm Expression Resources
TypeCollection...Seydoux lab website . Co-CRISPR plasmids that facilitate detection of genome-editing events. Developed... -
Promega Plasmid Collection
TypeCollection...Link opens in a new window) is a structural complementation reporter system composed of a Large BiT (LgBiT... -
CRISPR Plasmids - Plants
TypeCollection... create A->G (or T->C on the opposite strand) mutations. ID Plasmid Gene/Insert Promoter Selectable Marker... -
Open Enzyme Collection
TypeCollection...Reverse Transcriptase (RNAse H deactivated by 3 mutations) 165556 pOpen-MMLV_RT (lack H) Moloney Murine ... -
CRISPR Plasmids - Tagging
TypeCollection...systematic and scalable method to create marker-free mutations, insertions, and deletions at any locus in C. ... -
Rinehart Lab Phosphoprotein Reagents
TypeCollection...reference spectra or phosphopeptide standards for quantitative assessments. The Mode #1 phosphosite library... -
Optogenetics AAV Preps
TypeCollection...plasmids available in Addgene's collection. Opsin Excitatory Wild-type ChR2 ChR2/H134R soCoChR ChR2/other ... -
Penn Vector Core Partnership with Addgene
TypeCollection...provide AAV viral preps, includes listing of transfer status for viral preps.... -
3 Tips to Improve HDR Efficiency for CRISPR Editing in Human Cells
TypeBlog Post...blocking mutation. Despite the fact that both the blocking mutation and our intended mutation were on ...or heterozygous mutations. 1. Increasing HDR accuracy with CRISPR/Cas-blocking mutations After genome editing...sequence. The idea was that these “blocking mutations” mutations prevent CRISPR from re-cutting the target...blocking mutations? This depends entirely on the locus you are editing, and if the blocking mutation needs...intended mutation while taking advantage of the improved efficiency provided by blocking mutations. Essentially...cut site to mutation distance and editing efficiency. 3. Optimizing "cut-to-mutation distance" for... Alzheimer mutations we study are heterozygous in patients. As the probability of mutation incorporation... -
Sequencing Primers
TypeGuide...LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase, reverse primer M13 Reverse CAGGAAACAGCTATGAC In lacZ...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase, forward primer SP6 ATTTAGGTGACACTATAG SP6 promoter, forward...GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae GPD promoter, forward primer GW-3' GCATGATGACCACCGATATG 3' ...pBR322ori-F GGGAAACGCCTGGTATCTTT pBRS322 origin, forward primer pBRforBam CTTGGAGCCACTATCGAC In pBR322 ... primer SP6 ATTTAGGTGACACTATAG SP6 promoter, forward primer SV40pA-R GAAATTTGTGATGCTATTGC SV40 polyA, ... primer T7 TAATACGACTCACTATAGGG T7 promoter, forward primer T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward... -
Site Directed Mutagenesis by PCR
TypeBlog Post...applies to plasmids, but may also facilitate genome editing. Tailored mutations are commonly introduced to endogeneous...brief, point-mutations can be introduced to plasmids using primers (with the desired mutation) in a PCR ...mutagenesis vastly facilitates the subsequent process of screening for succesfully mutated clones. Forward...introduction of specifically designed mutations (not limited to frame shift mutations). Consequently, site directed...restriction sites), in mapping of regulatory elements (to mutate promoters/enhancers in reporter constructs), in...high homology to the endogenous target, yet to facilitate the repair, the template should be resistant ...template, site-directed mutagenesis can be used to mutate the PAM sequence (an NGG sequence critical for ... -
Fluorescent Proteins 101: Photoactivatable Fluorescent Proteins
TypeBlog Post...photoswitched from a dark state to a bright fluorescent state (“kindling”), and from a bright state to a dark non-...be activated from low fluorescent states to high fluorescence states, they can change from one fluorescent...switched on from a state of dim or no fluorescence, to a brighter fluorescent state by exposure to a specific...Padron is photoconverted from a dark state, to an activated state, emitting bright green fluorescence.... and ability to switch from a dark state to a red fluorescent state make them useful for 2-color imaging...from Jellyfish (Aequorea victoria) GFP (wtGFP) by mutating Threonine 203 to Histidine (T203H) (1). wtGFP ...chromophore which contribute to the 2 peaks of wtGFP’s excitation spectrum- a major 397 nm peak and minor 475 nm...