We narrowed to 844 results for: Tat

...solanacearum species complex (Rssc) gene knockout and complementation constructs - Lahaye Lab Vaccinia virus ORF ...

...Seydoux lab website . Co-CRISPR plasmids that facilitate detection of genome-editing events. Developed...

...Link opens in a new window) is a structural complementation reporter system composed of a Large BiT (LgBiT...

... microtubule-associated protein tau with P301L mutation. 1 Tsuneya Ikezu 203840 pAAV-hSyn-Kir2.1WT-2A-...

...Reverse Transcriptase (RNAse H deactivated by 3 mutations) 165556 pOpen-MMLV_RT (lack H) Moloney Murine ...

...systematic and scalable method to create marker-free mutations, insertions, and deletions at any locus in C. ...

...reference spectra or phosphopeptide standards for quantitative assessments. The Mode #1 phosphosite library...

...plasmids available in Addgene's collection. Opsin Excitatory Wild-type ChR2 ChR2/H134R soCoChR ChR2/other ...

...provide AAV viral preps, includes listing of transfer status for viral preps....

...Reverse hU6-F GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase Forward SP6 ATTTAGGTGACACTATAG SP6 promoter Forward T3...promoter Forward T7 TAATACGACTCACTATAGGG T7 promoter Forward T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator ...GAL1 AATATACCTCTATACTTTAACGTC S. cerevisiae GAL1 promoter Forward Gal10pro-F GGTGGTAATGCCATGTAATATG S. ...GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae GPD promoter Forward GW-3' GCATGATGACCACCGATATG 3' end ...Forward pBR322ori-F GGGAAACGCCTGGTATCTTT pBRS322 origin Forward pBRforBam CTTGGAGCCACTATCGAC In pBR322 tet ...pBRforEco AATAGGCGTATCACGAGGC In pBR322, upstream of EcoRI site Forward pBRrevBam GGTGATGTCGGCGATATAGG In pBR322...

...blocking mutation. Despite the fact that both the blocking mutation and our intended mutation were on ...or heterozygous mutations. 1. Increasing HDR accuracy with CRISPR/Cas-blocking mutations After genome editing...sequence. The idea was that these “blocking mutations” mutations prevent CRISPR from re-cutting the target...blocking mutations? This depends entirely on the locus you are editing, and if the blocking mutation needs...intended mutation while taking advantage of the improved efficiency provided by blocking mutations. Essentially...cut site to mutation distance and editing efficiency.   3. Optimizing "cut-to-mutation distance" for... Alzheimer mutations we study are heterozygous in patients. As the probability of mutation incorporation...

...developed by mutating specific amino acid residues to reduce off-target editing. Some mutations disrupt interactions...off-target mutations in DNA, RNA, or both, and are recommended in contexts where such mutations would be...target DNA. Once the Cas9-gRNA complex binds a putative DNA target, the seed sequence (8–10 bases at the... and a gRNA will result in a diverse array of mutations (see: Validate genetic modification ). In most...amino acid deletions, insertions, or frameshift mutations leading to premature stop codons within the open...targeted gene. The ideal result is a loss-of-function mutation within the targeted gene. However, the strength...Catalytically inactive “dead” Cas9 (dCas9) contains mutations in both nuclease domains, D10A and H840A, resulting...

...applies to plasmids, but may also facilitate genome editing. Tailored mutations are commonly introduced to endogeneous...brief, point-mutations can be introduced to plasmids using primers (with the desired mutation) in a PCR ...mutagenesis vastly facilitates the subsequent process of screening for succesfully mutated clones. Forward...introduction of specifically designed mutations (not limited to frame shift mutations). Consequently, site directed...restriction sites), in mapping of regulatory elements (to mutate promoters/enhancers in reporter constructs), in...high homology to the endogenous target, yet to facilitate the repair, the template should be resistant ...template, site-directed mutagenesis can be used to mutate the PAM sequence (an NGG sequence critical for ...

...photoswitched from a dark state to a bright fluorescent state (“kindling”), and from a bright state to a dark non-...be activated from low fluorescent states to high fluorescence states, they can change from one fluorescent...switched on from a state of dim or no fluorescence, to a brighter fluorescent state by exposure to a specific...Padron is photoconverted from a dark state, to an activated state, emitting bright green fluorescence.... and ability to switch from a dark state to a red fluorescent state make them useful for 2-color imaging...from Jellyfish (Aequorea victoria) GFP (wtGFP) by mutating Threonine 203 to Histidine (T203H) (1). wtGFP ...chromophore which contribute to the 2 peaks of wtGFP’s excitation spectrum- a major 397 nm peak and minor 475 nm...

...improve these natural opsins by inducing point mutations to alter the absorption spectrum or adding trafficking...physiological pH and traffics well to the membrane. Excitatory (Depolarizing) ChR Variants The optogenetic toolbox... variants have been created via genetic point mutations, codon optimization, and chimeric fusion of domains... as light-gated, cation channels resulting in excitation (depolarization) of the neuron. Feature enhancements...photocurrent compared to CrChR2 450 ChETA E123T mutation; creates faster kinetics but reduces photocurrent...photocurrent amplitude 490 ChR/T159C T159C mutation; displays increased photocurrents 470 SFO/SSFO Step function...function Opsins and Stabilized Step Function Opsins. Mutations at C128 and D156 of CrChR delay the closing of...

...within atoms to a higher energy state. This process is called excitation. After a short period, the electrons...lower energy state, whereby a photon is emitted. This step is called emission. During excitation, some of ...speak of excitation and emission spectra. Both spectra possess clear maxima where excitation and emission... to the global maximum of PE's excitation spectrum where the excitation efficiency is much greater. As...signal.   Figure 2: Excitation and emission spectra for PE. The excitation spectrum shows two maxima...While APC's global excitation maximum lies around 650 nm, APC-Cy7's global excitation maximum is about ... Figure 3: Excitation and emission spectra for APC and APC-Cy7. While the excitation spectra of both...

...culture, so bacteria must be grown in a turbidostat. Only mutate particular types of nucleotides. Both...rate was 2.5 x 10-6 mutations per nucleotide per generation vs. 10 x 10-10 mutations per nucleotide per...increase the mutation rate and extend the editing window of EvolvR: (1) two additional mutations to PolI3M...many known spectinomycin resistance mutations, several new mutations were identified by targeting EvolvR...to generate specific mutations in your plasmids Use REPLACER Mutagenesis to mutate your plasmid Resources... sequence can help scientists identify and/or facilitate the evolution of new phenotypes, and forward ...bacterial growth conditions in order to maximize the mutation rate. For example the Phage Assisted Continuous...

...Surveyor® or T7E1) for mutation detection. While these methods paved the way for mutation validation, we found...individual target molecules based on their mutation status. The drop-off probe is designed to perfectly...and is not capable of binding a mutated target. The amount of both mutated and wild type target in each ...samples with mono-allelic mutations versus those with the bi-allelic mutations typically desired when screening... comes time to (hopefully) validate successful mutation of your favourite gene, there are several different... to help guide you through the rough waters of mutation validation, such as this "CRISPR 101" post. Next-generation...Since there are many thousands of partitions, statistical modelling can be used to determine the actual...

...fluorophore primarily depends on the excitation power and the excitation wavelength. A fluorophore is less...absorb the excitation light less efficiently. Similarly, decreasing the power of the excitation light reduces...acquired at low excitation powers. Note, however, that, at a 14-fold higher excitation power, the photostability...lightbulb or exchanging excitation filters). This avoids substantial changes in excitation power and will help...reduces the number of excitation/emission cycles per unit of time, decreasing the likelihood that a fluorophore...story. The photobleaching rate does not depend on excitation power in a linear fashion. This implies that ...Cranfill et al, 2016). This non-linear dependence on excitation power is important since different fluorescence...

... electrons are elevated from a ground state to an excited state through the absorption of photons. After... elevation in this excited state, the electron returns to its ground state by emitting a photon with slightly...10 nm) and overlap of excitation profiles is vital for the accurate interpretation of FRET-based experiments... or the difference in wavelength between peak excitation spectrum and emission spectrum. Fluorescent dyes...chemical structure, leading to differences in their excitation and emission wavelengths, which are pivotal in...dye is fluorescein isothiocyanate (FITC), with excitation and emission peaks at 495 and 517 nm. FITC binds...this include coupling to an antibody, whereby excitation of blue light will indicate where FITC is bound...