We narrowed to 131 results for: mia

1. Sequencing Options for CRISPR Genotyping

   Type

   Blog Post

   ...establish standardized validation techniques for academia, industry, and especially the clinic. Popular ...

2. Custom CRISPR Screens & the Green Listed Software

   Type

   Blog Post

   ...vulnerabilities and therapeutic targets in acute myeloid leukemia." Cell reports 17.4 (2016): 1193-1205. PubMed ...

3. Plasmids 101: Modular Cloning Applications and Kits

   Type

   Blog Post

   ...Editing: One‐shot Generation of 8× Nicotiana Benthamiana and 12× Arabidopsis Mutants.” The Plant Journal...

4. With an Eye Towards the Future, We Look Back at the March for Science

   Type

   Blog Post

   ... our research to family and friends outside of academia. But the fact is that we are citizens first and...

5. Starter Guide to induced Pluripotent Stem Cells (iPSCs) Part 2:  Reprogramming and Transdifferentiation

   Type

   Blog Post

   ...liver and ameliorates streptozotocin-induced hyperglycemia. Nat Med, 2000. 6(5): p. 568-72. PubMed PMID...

6. Prime Editing: Adding Precision and Flexibility to CRISPR Editing

   Type

   Blog Post

   ...editor simply fused the wild-type Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase to the C-terminus...

7. Sequencing Primers

   Type

   Guide

   ...primer MMLV-F ATCAGTTCGCTTCTCGCTTC Moloney murine leukemia virus LTR (MoMuLV), forward primer mPGK-F CATTCTGCACGCTTCAAAAG...forward primer pZIP TCCTTTCCAGCGAGGTTCTA Murine leukemia virus (MuLV), reverse primer RCAS-F ACATGGGTGGTGGTATAGCGCTTGCG...

8. Delivery Methods for Generating iPSCs

   Type

   Blog Post

   ...first iPSCs were generated with Moloney murine leukemia virus (MMLV)-derived retroviruses. Retroviral ...

9. Using AAV for Neuronal Tracing

   Type

   Blog Post

   ...PMCID: PMC3275419. Maday, S., Twelvetrees, A.E., Moughamian, A.J., and Holzbaur, E.L.F. (2014). Axonal Transport...

10. CRISPR Guide

    Type

    Guide

    ...replace” gene editing method in which Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) is fused...Cas9 H840A nickase and M-MLV RT (Moloney Murine Leukemia Virus Reverse Transcriptase) for "search and replace...

11. 27 Hot Plasmids from 2016

    Type

    Blog Post

    ...bp) and large (up to 120 kb) deletions in N. benthamiana and Arabidopsis. The authors found that deletion...