...Editing: One‐shot Generation of 8× Nicotiana Benthamiana and 12× Arabidopsis Mutants.” The Plant Journal...

... our research to family and friends outside of academia. But the fact is that we are citizens first and...

...liver and ameliorates streptozotocin-induced hyperglycemia. Nat Med, 2000. 6(5): p. 568-72. PubMed PMID...

...editor simply fused the wild-type Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase to the C-terminus...

...first iPSCs were generated with Moloney murine leukemia virus (MMLV)-derived retroviruses. Retroviral ...

...PMCID: PMC3275419. Maday, S., Twelvetrees, A.E., Moughamian, A.J., and Holzbaur, E.L.F. (2014). Axonal Transport...

...primer MMLV-F ATCAGTTCGCTTCTCGCTTC Moloney murine leukemia virus LTR (MoMuLV), forward primer mPGK-F CATTCTGCACGCTTCAAAAG...forward primer pZIP TCCTTTCCAGCGAGGTTCTA Murine leukemia virus (MuLV), reverse primer RCAS-F ACATGGGTGGTGGTATAGCGCTTGCG...

...bp) and large (up to 120 kb) deletions in N. benthamiana and Arabidopsis. The authors found that deletion...

...replace” gene editing method in which Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) is fused...Cas9 H840A nickase and M-MLV RT (Moloney Murine Leukemia Virus Reverse Transcriptase) for "search and replace...

...Addgene were derived from MoMLV (Moloney Murine Leukemia Virus) or MSCV (Murine Stem Cell Virus) sequences...