We narrowed to 12 results for: mia
-
TypeCollection...growth factor receptor) AUTS9, HGFR, RCCP2, c-Met MIA melanoma inhibitory activity CD-RAP MIF macrophage...LIF leukemia inhibitory factor (cholinergic differentiation factor) CDF, DIA, HILDA LIFR leukemia inhibitory...LY57, MGC111051, SLP-65, SLP65 BTK Bruton agammaglobulinemia tyrosine kinase AGMX1, AT, ATK, BPK, IMD1...epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) ERBB,...motilin receptor GPR38, MTLR1 MPL myeloproliferative leukemia virus oncogene C-MPL, CD110, MPLV, TPOR MSTN myostatin...platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog) FLJ12858...thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian) AR7, ...
-
SARS-CoV-2 Pseudotyped Virus
TypeCollection...functional components of one virus (such as HIV, murine leukemia virus, and vesicular stomatitis virus G) are packaged...collection: HIV-based lentiviral particles Murine leukemia-based retroviral particles Vesicular stomatitis... -
Open Enzyme Collection
TypeCollection...insert 165546 pOpen-MMLV_RT (mut H) Moloney Murine Leukemia Virus (MMLV) Reverse Transcriptase (RNAse H deactivated...) 165556 pOpen-MMLV_RT (lack H) Moloney Murine Leukemia Virus (MMLV) Reverse Transcriptase RNaseH - (lacking... -
Ras Pathway
TypeCollection...proto-oncogene Raf-1 proto-oncogene RAL RALA RALB v-ral simian leukemia viral oncogene homolog (ras related) RALBP1... -
Validated gRNA Sequences
TypeCollection...PDS N. benthamiana GCCGTTAATTTGAGAGTCCA 46966 cut S. pyogenes 23929340 Kamoun PDS1 N. benthamiana multiple... -
Resolute Plasmid Collection
TypeCollection...public-private partnership of 13 members from industry and academia financed by the Innovative Medicine Initiative... -
AAV Molecular Tools
TypeCollection...mutant (D377Y) murine PCSK9 for studying hypercholesterolemia and atherosclerosis. 8 Bentzon 176267 pAAV-FLEX-P301L... -
CRISPR Plasmids - Prime Edit
TypeCollection...most other prime editors use the Moloney murine leukemia virus (M-MLV) reverse transcriptase. Engineering... -
TALEN Guide
TypeCollection...Christian M, Wang L, Zhang Y, Schmidt C, Baller JA, Somia NV, Bogdanove AJ, Voytas DF. Nucleic Acids Res. ... -
CRISPR Guide
TypeCollection...replaceā gene editing method in which Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) is fused...Cas9 H840A nickase and M-MLV RT (Moloney Murine Leukemia Virus Reverse Transcriptase) for "search and replace... -
Genomic Deletions in Mammalian Cell Lines
TypeCollection...protocol is described in detail for murine erythroleukemia (MEL) cells, a suspension cell line. The culture... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection...Methods, September 2007, Vol. 4 No. 9, pp. 741-6 Shemiakina et al. : Nature Communications, November 2012...