We narrowed to 3 results for: mia

1. Gamma-Retroviral Vector Guide

   Type

   Guide

   ... include murine leukemia virus (MLV), murine sarcoma virus (MSV), and feline leukemia virus (FeLV). Retroviruses...including: Gibbon Ape Leukemia Virus (GALV) — T and B cell transduction Murine Leukemia Virus (MuLV) and HIV...(2014). Enhancers are major targets for murine leukemia virus vector integration. Journal of Virology ... & Cichutek, K. (1997). Pseudotyping of murine leukemia virus with the envelope glycoproteins of HIV generates...

2. Sequencing Primers

   Type

   Guide

   ...primer MMLV-F ATCAGTTCGCTTCTCGCTTC Moloney murine leukemia virus LTR (MoMuLV), forward primer mPGK-F CATTCTGCACGCTTCAAAAG...forward primer pZIP TCCTTTCCAGCGAGGTTCTA Murine leukemia virus (MuLV), reverse primer RCAS-F ACATGGGTGGTGGTATAGCGCTTGCG...

3. CRISPR Guide

   Type

   Guide

   ...replace” gene editing method in which Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) is fused...Cas9 H840A nickase and M-MLV RT (Moloney Murine Leukemia Virus Reverse Transcriptase) for "search and replace...