...primer MMLV-F ATCAGTTCGCTTCTCGCTTC Moloney murine leukemia virus LTR (MoMuLV), forward primer mPGK-F CATTCTGCACGCTTCAAAAG...forward primer pZIP TCCTTTCCAGCGAGGTTCTA Murine leukemia virus (MuLV), reverse primer RCAS-F ACATGGGTGGTGGTATAGCGCTTGCG...

...replace” gene editing method in which Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) is fused...Cas9 H840A nickase and M-MLV RT (Moloney Murine Leukemia Virus Reverse Transcriptase) for "search and replace...

...Addgene were derived from MoMLV (Moloney Murine Leukemia Virus) or MSCV (Murine Stem Cell Virus) sequences...