Skip to main content
Addgene

We narrowed to 131 results for: mia

Showing: 1 - 20 of 131 results
  1. 9 Tips to Achieve Success in Academia

    Type
    Blog Post
    ....   Advice for success in academia How can we shape our time in academia to maximize productivity and...who's seen every spurious result under the sun. Academia is about convincing results, and nothing is more...pragmatic.” Advice for pursuing careers outside of academia Recently, graduate students and postdocs have...have become more aware of careers outside of academia. How do PIs assist their mentees who have goals outside...recommends that a student interested in leaving academia should present their research at conferences to... applicable to a variety of careers outside of academia. She has had previous graduate students and postdocs... success in academia...
  2. Walking beside Academia and giving it a high five: My transition from graduate work to a position at Addgene

    Type
    Blog Post
    ...outside of academia. These roles can include positions, like mine, that help support academia but the skills... did I join Addgene? Was I jaded by my time in academia? Did I run screaming from the lab like the cartoon... my story demonstrates that transitioning from academia doesn’t have to mean abandoning it or running ...more glad that I thought about careers outside of academia during my graduate training. PhDs have many roles...
  3. Immunology Research Plasmids and Resources

    Type
    Collection
    ...growth factor receptor) AUTS9, HGFR, RCCP2, c-Met MIA melanoma inhibitory activity CD-RAP MIF macrophage...LIF leukemia inhibitory factor (cholinergic differentiation factor) CDF, DIA, HILDA LIFR leukemia inhibitory...LY57, MGC111051, SLP-65, SLP65 BTK Bruton agammaglobulinemia tyrosine kinase AGMX1, AT, ATK, BPK, IMD1...epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian) ERBB,...motilin receptor GPR38, MTLR1 MPL myeloproliferative leukemia virus oncogene C-MPL, CD110, MPLV, TPOR MSTN myostatin...platelet-derived growth factor beta polypeptide (simian sarcoma viral (v-sis) oncogene homolog) FLJ12858...thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian) AR7, ...
  4. SARS-CoV-2 Pseudotyped Virus

    Type
    Collection
    ...functional components of one virus (such as HIV, murine leukemia virus, and vesicular stomatitis virus G) are packaged...collection: HIV-based lentiviral particles Murine leukemia-based retroviral particles Vesicular stomatitis...
  5. Open Enzyme Collection

    Type
    Collection
    ...insert 165546 pOpen-MMLV_RT (mut H) Moloney Murine Leukemia Virus (MMLV) Reverse Transcriptase (RNAse H deactivated...) 165556 pOpen-MMLV_RT (lack H) Moloney Murine Leukemia Virus (MMLV) Reverse Transcriptase RNaseH - (lacking...
  6. Ras Pathway

    Type
    Collection
    ...proto-oncogene Raf-1 proto-oncogene RAL RALA RALB v-ral simian leukemia viral oncogene homolog (ras related) RALBP1...
  7. Validated gRNA Sequences

    Type
    Collection
    ...PDS N. benthamiana GCCGTTAATTTGAGAGTCCA 46966 cut S. pyogenes 23929340 Kamoun PDS1 N. benthamiana multiple...
  8. Academic vs. Industry Postdocs

    Type
    Blog Post
    ..., I was still incredibly nervous about leaving academia. A lot of academics tend to view industry as “...pros and cons to postdocs in both industry and academia. Pros and cons: The academic vs. industry postdoc...positions. Of course, if your goal is to enter academia, it is easier to make that transition from an ... be a bit of a mystery to graduate students in academia. Getting a drug to the market usually takes over...publication is expected, the process is similar to academia. The only difference is that your paper will be...may not be a requirement. Your manager: Unlike academia, promotions in industry are based on people’s ... simply no longer allowed to have postdocs. In academia, as many of us know, this is not always the case...
  9. Extracurricular Activities for a Strong Science Career Path

    Type
    Blog Post
    ...hasn’t been asked the question: “Academia or industry?” Once academia was the clear answer with a well-defined...match qualified scientists to jobs in industry, academia, and government. This great resource allows the... to gather more information Follow people in academia, industry, and government on social media (Twitter...will help reveal potential opportunities beyond academia. Once a profession sounds interesting, TAKE ACTION...of skills across professions within and beyond academia. Extracurricular Activities Professional ... competitive positions both within and outside academia. Use EAs to network and learn new skills, while...
  10. What Do I Do Now? Academic v. Non-Academic Career Decisions

    Type
    Blog Post
    ...traditional academic silo to tenured professor.  Non-academia encompasses millions of choices including pharma...anymore.   Since most scientists start out in academia, it is especially important for graduate students...scientists just like you What is different about academia? Publishing in peer reviewed journals is absolutely...grants and renewals What is different about non-academia? Scientific publications are a nice to have, ... academia... non-academia...
  11. Changing Labor Laws Bring Increased Postdoc Wages

    Type
    Blog Post
    ... is having a major effect on scientists within academia, most particularly postdocs working in the U.S...have been made by multiple organizations across academia). Increased postdoc wages, overtime tracking? .... Future actions for junior scientists and for academia Changes are afoot for the postdoc population, ... research enterprise, there is no easy way for academia to absorb the extra cost of increased salaries...the majority of postdocs end up getting outside academia. There is also a valuable lesson for the enterprise... of their peer institutions. The issues facing academia are not going away, and it is becoming ever clearer...
  12. Evolution of Lab Techniques

    Type
    Blog Post
    ...mutation is the genetic test used for sickle cell anemia (2). Southern blotting, in conjunction with restriction...the mutated β globin gene that causes sickle cell anemia. The mutation happens to destroy a sequence recognized...a sample from an individual without sickle cell anemia, two DNA fragments are observed because the DNA...where MstII cuts. In a patient with sickle cell anemia the enzyme does not cut the DNA so only one DNA... "A sensitive new prenatal test for sickle-cell anemia." New England Journal of Medicine 307.1 (1982):...Kathleen, and Daniel Nathans. "Specific cleavage of simian virus 40 DNA by restriction endonuclease of Hemophilus...
  13. Resolute Plasmid Collection

    Type
    Collection
    ...public-private partnership of 13 members from industry and academia financed by the Innovative Medicine Initiative...
  14. Finding Your Science Policy Path

    Type
    Blog Post
    ...challenging part of jumping into this career path from academia is the uncertainty of it all. Though I had spent...university policy to combat sexual harassment in academia or a large company who decides how they are going...researchers who have decided to transition out of academia from graduate school or a postdoc. But some are...either a sabbatical year or transition away from academia as tenured professors. There’s never a bad time...positions, but will also make your transition from academia to the policy world much smoother.  Action Items...
  15. Synthetic Biology, Artificial Chromosomes, iGEM & More - Interview with Tom Ellis

    Type
    Blog Post
    ...ended up in academia and his research goals. From grad school to a startup and back to academia. Chapter ... Career advice for anyone pursuing a career in academia. Learning how to build a lab and a research program...program and difficulties with work-life balance in Academia. Will it all pay off? Chapter 2: The Centre for...
  16. AAV Molecular Tools

    Type
    Collection
    ...mutant (D377Y) murine PCSK9 for studying hypercholesterolemia and atherosclerosis. 8 Bentzon 176267 pAAV-FLEX-P301L...
  17. Advice for Moving Into Sales After Your Science Postdoc

    Type
    Blog Post
    .... I sold out, well in part that’s what leaving academia feels like for a lot of researchers. For many ... struggled with the questions of “Will I leave academia?” and "What type of science careers would would...the time I decided to look for work outside of academia, a job as a ‘Cancer Marketing Coordinator’ came.... For most PhDs looking at careers outside of academia, sales and marketing can be great places to start...
  18. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ...most other prime editors use the Moloney murine leukemia virus (M-MLV) reverse transcriptase. Engineering...
  19. The Future of Research Symposium Boston 2015

    Type
    Blog Post
    ... (3), showing that the ‘standard’ pathway into academia may in fact be just another ‘alternative’ career...closely reflect the number of positions available in academia (5, 6). Academic data and the labor market for...jobs are there for STEM graduates and postdocs in academia, industry and other areas of employment? How many... academia...
Showing: 1 - 20 of 131 results