Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 846 results for: tat

Showing: 121 - 140 of 846 results

  1. CRISPR Plasmids - Base Edit

    Type
    Collection
    ...spectrum of single-nucleotide variants (somatic hypermutation) in a wider editing window, and are thus well...

  2. Synthetic Biology - Overview

    Type
    Collection
    ...leading synthetic biologists around the world to facilitate the sharing of parts and information. Addgene...

  3. AAV for Neuronal Tracing

    Type
    Collection
    ...infect any neighboring cells. Thus, through complementation, G-deleted rabies virus can spread to monosynaptically...

  4. Adenovirus Plasmids

    Type
    Collection
    ...modular inserts for seamless assembly of multiple mutations, alterations, or transgene insertions into single...

  5. AAV Molecular Tools

    Type
    Collection
    ... microtubule-associated protein tau with P301L mutation 1 Ikezu Don’t See What You’re Looking For? Our...

  6. Viral Vector Guides and Plasmids

    Type
    Collection
    ...replication-incompetent. Specific genes have been mutated or deleted to prevent uncontrolled viral replication...

  7. Distribution to Industry

    Type
    Collection
    ...Library name Type PI Description HR700_TP53 Exon Mutation Libraries CRISPR Thorsten Stiewe Use these donor...

  8. Microbiology Resources

    Type
    Collection
    ...solanacearum species complex (Rssc) gene knockout and complementation constructs - Lahaye Lab Vaccinia virus ORF ...

  9. Worm Expression Resources

    Type
    Collection
    ...Seydoux lab website . Co-CRISPR plasmids that facilitate detection of genome-editing events. Developed...

  10. Promega Plasmid Collection

    Type
    Collection
    ...Link opens in a new window) is a structural complementation reporter system composed of a Large BiT (LgBiT...

  11. CRISPR Plasmids - Plants

    Type
    Collection
    ... create A->G (or T->C on the opposite strand) mutations. ID Plasmid Gene/Insert Promoter Selectable Marker...

  12. Open Enzyme Collection

    Type
    Collection
    ...Reverse Transcriptase (RNAse H deactivated by 3 mutations) 165556 pOpen-MMLV_RT (lack H) Moloney Murine ...

  13. CRISPR Plasmids - Tagging

    Type
    Collection
    ...systematic and scalable method to create marker-free mutations, insertions, and deletions at any locus in C. ...

  15. Optogenetics AAV Preps

    Type
    Collection
    ...plasmids available in Addgene's collection. Opsin Excitatory Wild-type ChR2 ChR2/H134R soCoChR ChR2/other ...

  17. 3 Tips to Improve HDR Efficiency for CRISPR Editing in Human Cells

    Type
    Blog Post
    ...blocking mutation. Despite the fact that both the blocking mutation and our intended mutation were on ...or heterozygous mutations. 1. Increasing HDR accuracy with CRISPR/Cas-blocking mutations After genome editing...sequence. The idea was that these “blocking mutations” mutations prevent CRISPR from re-cutting the target...blocking mutations? This depends entirely on the locus you are editing, and if the blocking mutation needs...intended mutation while taking advantage of the improved efficiency provided by blocking mutations. Essentially...cut site to mutation distance and editing efficiency.   3. Optimizing "cut-to-mutation distance" for... Alzheimer mutations we study are heterozygous in patients. As the probability of mutation incorporation...

  18. Sequencing Primers

    Type
    Guide
    ...LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase, reverse primer M13 Reverse CAGGAAACAGCTATGAC In lacZ...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase, forward primer SP6 ATTTAGGTGACACTATAG SP6 promoter, forward...GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae GPD promoter, forward primer GW-3' GCATGATGACCACCGATATG 3' ...pBR322ori-F GGGAAACGCCTGGTATCTTT pBRS322 origin, forward primer pBRforBam CTTGGAGCCACTATCGAC In pBR322 ... primer SP6 ATTTAGGTGACACTATAG SP6 promoter, forward primer SV40pA-R GAAATTTGTGATGCTATTGC SV40 polyA, ... primer T7 TAATACGACTCACTATAGGG T7 promoter, forward primer T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward...

  19. Site Directed Mutagenesis by PCR

    Type
    Blog Post
    ...applies to plasmids, but may also facilitate genome editing. Tailored mutations are commonly introduced to endogeneous...brief, point-mutations can be introduced to plasmids using primers (with the desired mutation) in a PCR ...mutagenesis vastly facilitates the subsequent process of screening for succesfully mutated clones. Forward...introduction of specifically designed mutations (not limited to frame shift mutations). Consequently, site directed...restriction sites), in mapping of regulatory elements (to mutate promoters/enhancers in reporter constructs), in...high homology to the endogenous target, yet to facilitate the repair, the template should be resistant ...template, site-directed mutagenesis can be used to mutate the PAM sequence (an NGG sequence critical for ...

  20. Fluorescent Proteins 101: Photoactivatable Fluorescent Proteins

    Type
    Blog Post
    ...photoswitched from a dark state to a bright fluorescent state (“kindling”), and from a bright state to a dark non-...be activated from low fluorescent states to high fluorescence states, they can change from one fluorescent...switched on from a state of dim or no fluorescence, to a brighter fluorescent state by exposure to a specific...Padron is photoconverted from a dark state, to an activated state, emitting bright green fluorescence.... and ability to switch from a dark state to a red fluorescent state make them useful for 2-color imaging...from Jellyfish (Aequorea victoria) GFP (wtGFP) by mutating Threonine 203 to Histidine (T203H) (1). wtGFP ...chromophore which contribute to the 2 peaks of wtGFP’s excitation spectrum- a major 397 nm peak and minor 475 nm...
Showing: 121 - 140 of 846 results