We narrowed to 838 results for: tat
-
TypeCollection...modification, or variant. ID Plasmid Description Mutations Industry PI Due to export control regulations,...
-
CRISPR Plasmids and Resources
TypeCollection...enzymes generate double strand breaks (DSBs). Nick Mutated Cas nickase enzymes generate single-strand DNA ... -
CRISPR Plasmids - Base Edit
TypeCollection...spectrum of single-nucleotide variants (somatic hypermutation) in a wider editing window, and are thus well... -
Synthetic Biology - Overview
TypeCollection...leading synthetic biologists around the world to facilitate the sharing of parts and information. Addgene... -
AAV for Neuronal Tracing
TypeCollection...infect any neighboring cells. Thus, through complementation, G-deleted rabies virus can spread to monosynaptically... -
Adenovirus Plasmids
TypeCollection...modular inserts for seamless assembly of multiple mutations, alterations, or transgene insertions into single... -
Distribution to Industry
TypeCollection...Library name Type PI Description HR700_TP53 Exon Mutation Libraries CRISPR Thorsten Stiewe Use these donor... -
Microbiology Resources
TypeCollection...solanacearum species complex (Rssc) gene knockout and complementation constructs - Lahaye Lab Vaccinia virus ORF ... -
Worm Expression Resources
TypeCollection...Seydoux lab website . Co-CRISPR plasmids that facilitate detection of genome-editing events. Developed... -
Viral Vectors
TypeCollection...delivery has many advantages for research. Viruses facilitate the delivery of genetic information to hard-to-transfect... -
CRISPR Plasmids - Plants
TypeCollection... create A->G (or T->C on the opposite strand) mutations. ID Plasmid Gene/Insert Promoter Selectable Marker... -
Open Enzyme Collection
TypeCollection...Reverse Transcriptase (RNAse H deactivated by 3 mutations) 165556 pOpen-MMLV_RT (lack H) Moloney Murine ... -
Rinehart Lab Phosphoprotein Reagents
TypeCollection...reference spectra or phosphopeptide standards for quantitative assessments. The mode #1 phosphosite library... -
Tetracycline Inducible Expression
TypeCollection...important for tetracycline-dependent repression. Mutating these residues led to the development of a reverse... -
CRISPR Plasmids - Tagging
TypeCollection...systematic and scalable method to create marker-free mutations, insertions, and deletions at any locus in C. ... -
Optogenetics AAV Preps
TypeCollection...plasmids available in Addgene's collection. Opsin Excitatory Wild-type ChR2 ChR2/H134R soCoChR ChR2/other ... -
Penn Vector Core Partnership with Addgene
TypeCollection...provide AAV viral preps, includes listing of transfer status for viral preps.... -
Sequencing Primers
TypeGuide...LucNrev CCTTATGCAGTTGCTCTCC 5' end of luciferase, reverse primer M13 Reverse CAGGAAACAGCTATGAC In lacZ...GGGCTGGCAAGCCACGTTTGGTG 3' end of glutathione-S-transferase, forward primer SP6 ATTTAGGTGACACTATAG SP6 promoter, forward...GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae GPD promoter, forward primer GW-3' GCATGATGACCACCGATATG 3' ...pBR322ori-F GGGAAACGCCTGGTATCTTT pBRS322 origin, forward primer pBRforBam CTTGGAGCCACTATCGAC In pBR322 ... primer SP6 ATTTAGGTGACACTATAG SP6 promoter, forward primer SV40pA-R GAAATTTGTGATGCTATTGC SV40 polyA, ... primer T7 TAATACGACTCACTATAGGG T7 promoter, forward primer T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward... -
CRISPR Guide
TypeGuide...developed by mutating specific amino acid residues to reduce off-target editing. Some mutations disrupt interactions...off-target mutations in DNA, RNA, or both, and are recommended in contexts where such mutations would be...target DNA. Once the Cas9-gRNA complex binds a putative DNA target, the seed sequence (8–10 bases at the... and a gRNA will result in a diverse array of mutations (see: Validate genetic modification ). In most...amino acid deletions, insertions, or frameshift mutations leading to premature stop codons within the open...targeted gene. The ideal result is a loss-of-function mutation within the targeted gene. However, the strength...Catalytically inactive “dead” Cas9 (dCas9) contains mutations in both nuclease domains, D10A and H840A, resulting... -
Optogenetics Guide
TypeGuide...improve these natural opsins - by inducing point mutations to alter the absorption spectrum or adding trafficking...physiological pH and trafficks well to the membrane. Excitatory (Depolarizing) ChR Variants. The optogenetic ... variants have been created via genetic point mutations, codon optimization, and chimeric fusion of domains... as light-gated, cation channels resulting in excitation (depolarization) of the neuron. Feature enhancements...photocurrent compared to CrChR2 450 ChETA E123T mutation; creates faster kinetics but reduces photocurrent...photocurrent amplitude 490 ChR/T159C T159C mutation; displays increased photocurrents 470 SFO/SSFO Step function...function Opsins and Stabilized Step Function Opsins. Mutations at C128 and D156 of CrChR delay the closing of...