Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 254 results for: tre promoter

Showing: 121 - 140 of 254 results

  2. Plant Plasmids and Resources

    Type
    Collection
    ...containing promoters that drive general and species-specific gene expression (see the column ‘promoter’ in the...for, such as the promoter or cloning method of choice. ID Plasmid Description Promoter Cloning Method PI..., such as the promoter or fluorescent protein of choice. ID Plasmid Description Promoter PI Return to ...Synthetic Biology Research Centre (Link opens in a new window) - The initiative promotes interdisciplinary exchange... nucleases, base editors, gRNA backbones, and promoters for expression in monocots and dicots - Vladimir...modules for assembly of CRISPR/Cas9 constructs - Sylvestre Marillonnet and Johannes Stuttmann. Combined fluorescent...

  3. What's New in CRISPR - December 2019

    Type
    Blog Post
    ...this system is tunable via a rhamnose-inducible promoter. While this system was optimized for Burkholderia...deaminase (TadA) to a catalytically impaired Streptococcus pyogenes Cas9. They called this editor Target-ACE...

  4. CRISPR Plasmids - Mammalian Expression

    Type
    Collection
    ...lower efficiency than NHEJ. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Browse CRISPR...for directed evolution. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Nick CRISPR/Cas...-directed repair (HDR). ID Plasmid Gene/Insert Promoter Selectable Marker Publication Prime Edit Cas9 ...edits on an RT template. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Activate Catalytically...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest...to your specific locus. ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Interfere Catalytically...Design your gRNA to target your gene of interest’s promoter/enhancer or the beginning of the coding sequence...

  5. CRISPR Plasmids - Bacteria

    Type
    Collection
    ...lower efficiency than NHEJ. ID Plasmid Gene/Insert Promoter PI Publication Browse CRISPR Plasmids By Function... on the opposite strand) mutations. ID Plasmid Promoter PI Publication Nick CRISPR/Cas nickase mutants...-directed repair (HDR). ID Plasmid Gene/Insert Promoter PI Publication Prime Edit Cas9 H840A nickase fused...edits on an RT template. ID Plasmid Gene/Insert Promoter PI Publication Activate Catalytically dead dCas9...gRNA sequence to direct the dCas9-activator to promoter or regulatory regions of your gene of interest...to your specific locus. ID Plasmid Gene/Insert Promoter PI Publication Interfere Catalytically dead dCas9...Design your gRNA to target your gene of interest’s promoter/enhancer or the beginning of the coding sequence...

  6. Four Ways to Package Transgenes That Exceed the Size Limit of Adeno-associated Virus

    Type
    Blog Post
    ...AAV encoding part A of the transgene contains a promoter and the 5’-fragment of the transgene, followed... encoding part A of the transgene contains the promoter, the 5’ half of the transgene, a splice donor ...degron, or degradation sequence, upstream of the 5’ splice donor and downstream of the 3’ splice acceptor of...of wild-type dystrophin in normal muscles, mice treated with the overlapping split vector had an improvement...codon from donor A in any of the reading frames downstream of the gRNA target site so that transcripts undergo...

  7. Caltech Systemic Capsids

    Type
    Collection
    ... window) . Browse Available PHP.eB AAV ID Name Promoter Description Category PI Controls 28306 pAAV-FLEX-tdTomato... #103006) . Browse Available PHP.S AAV ID Name Promoter Description Category PI 28306 pAAV-FLEX-tdTomato...#127847) . Browse Available PHP.V1 AAV ID Name Promoter Description Category PI 104052 pAAV-CAG-DIO-EYFP...#185136) . Browse Available MaCPNS1 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#185137) . Browse Available MaCPNS2 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#175004) . Browse Available CAP-B10 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...#175005) . Browse Available CAP-B22 AAV ID Name Promoter Description Category PI 37825 pAAV-CAG-GFP CAG...

  8. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...specific times or locations using cell-specific promoters or inducible systems, you can precisely control...fragments and placed under the control of different promoters. Expression of both fragments in the same cell... lox-STOP-lox shRNA constructs, Cre expression promotes shRNA expression. Gene Switch: These constructs...plasmids based on your expression system of choice, promoter, or search by inducible system (e.g., search for...Recombinase Plasmids ID Plasmid Description Vector Type Promoter PI Additional Addgene resources Explore our full...Recombinase Plasmids ID Plasmid Description Vector Type Promoter PI Additional Addgene resources Search our full...

  9. Science as Art

    Type
    Blog Post
    ...emotional response within the viewer, which could promote conservation efforts, as the subject matter is ...display.   Many universities are now following the trend and encouraging departments to showcase the work...

  10. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...interest to create a luciferase reporter Promoter Measure promoter strength pBV-Luc - Luciferase ...plasmid with a promoter that will be functional in your host organism. Host Relevant Promoters Representative...sgRNA/PTG with rice snoRNA U3 promoter and Cas9 with rice ubiquitin promoter for Agrobacterium-mediated ...proteins, a multiple cloning site (MCS), an inducible promoter, and/or a selectable marker. They are frequently...T-DNA entry plasmid (attR1 & attR2); Zea mays Ubi1 promoter and Hygromiycin resistance marker Also see more... expression under the metallothionein promoter pFastBac LIC and pFastBac Dual LIC - Vectors from...Gileadi lab Worm unc-54, variety of worm gene promoters C. elegans vector kit - Collection...

  11. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ...Chien lab (Kwan et al., 2007) and includes four promoters, six fluorophores with nonoverlapping emission...neurodegenerative diseases, the Cole Lab selected promoters for cell types directly linked to disease, including... components can be controlled by a variety of promoters for versatile and robust engineering. These components...monocytogenes  pCSW21  Yes  pJH376 Yes   acrIIA3 Streptococcus pyogenes  pCSW24  N/A (Toxic) pJH375  No  ...

  12. CRISPR Plasmids - Base Edit

    Type
    Collection
    ...Gene/Insert Promoter Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert Promoter Selectable...Gene/Insert Promoter Selectable Marker PI Publication Yeast ID Plasmid Gene/Insert Promoter Selectable ...PI Publication Zebrafish ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Do you have suggestions...engineered to convert adenosine to inosine, which is treated like guanosine by the cell, creating an A to G ...

  13. mTOR Pathway

    Type
    Collection
    ...signals. mTORC2, which appears to signal upstream of Akt, also promotes cell survival and proliferation. mTOR...anabolic to catabolic processes. Active mTORC1 promotes protein and lipid synthesis, and increases energy... cancer. Loss of the tumor suppressor p53 also promotes aberrant mTORC1 activity, and multiple familial...mTORC1. The hyperactivation of mTORC1 in cancer promotes the conditions needed for uncontrolled cell growth...responds to various signals, including amino acids, stress, oxygen, energy levels, and growth factors. mTORC1...ovarian, and liver cancers. mTORC1 is activated downstream of PI3K/Akt and MAPK/ERK, both of which are commonly...

  14. Arabidopsis in Education: How the Arabidopsis Biological Resource Center Brings Plant Science to Life

    Type
    Blog Post
    ...she focuses in public engagement in science and promoting plant science in K-12 education.     Additional...support. Growing capacity - ABRC outreach today Over the years, the outreach efforts of ABRC have grown. A... guest blogger Courtney Price, the Education & Outreach Specialist for the Arabidopsis Biological Resource...out to remedy that with the establishment of an outreach program in 2011. More than a model System - Arabidopsis...support from the National Science Foundation, ABRC’s outreach program kicked off with the release of 20 education...materials are available free-of-charge from the ABRC Outreach website. Seeds, which are free for K-12 teachers...staff reached more than 4,000 people through our outreach efforts. Our education partnerships have grown...

  15. Tag Your Favorite Yeast Genes with Ease

    Type
    Blog Post
    ... and partial gene deletion, overexpression (by promoter substitution), and tagging at either the N- or...site (TEV or PreScission), epitope tag (12xHis, 2xStrep, 3xFlag, Protein A, or V5), and selection marker...

  16. Supporting Rare Disease Research with BeHeard 2017

    Type
    Blog Post
    ...connecting patients to important resources and promoting research for rare disease cures. Through their...mesothelioma, there are currently no targeted treatments for peritoneal mesothelioma. Dr. Nabavi and colleagues...

  18. Antibodies 101: Fc Effector Functions

    Type
    Blog Post
    ...10.1016/j.it.2007.11.004 Xu Cao, et al. Promoting antibody-dependent cellular phagocytosis for effective...There are a lot of different receptors, but their downstream effects can be sorted into three main effector...functions may be useful for inducing immunity or treating diseases (Cao, et al, 2022). So the next time ...region contributes to affinity and specificity. Trends in Immunology, 29(2), 91–97. https://doi.org/10.1016...

  19. Validated gRNA Sequences

    Type
    Collection
    ...CYC1m promoter S. cerevisiae CTAGATATTAAAATGTCTAA 64379 activate S. pyogenes 23977949 Lu CYC1m promoter S.... or repression experiments use targets within promoters. When possible, the categories described on Addgene's... 46917 interfere S. pyogenes 23849981 Qi CYC1m promoter S. cerevisiae ACAGAGCACATGCATGCCAT 64385 activate...activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ACTAATACTTTCAACATTTT 64387 activate S. pyogenes...pyogenes 23977949 Lu CYC1m promoter S. cerevisiae ATATCGAATTCCTGCAGCCC 64382 activate S. pyogenes 23977949...23977949 Lu CYC1m promoter S. cerevisiae ATATTCTTTCCTTATACATT 64380 activate S. pyogenes 23977949 Lu CYC1m...GTTGAAAGTATTAGTTAAAG 64388 activate S. pyogenes 23977949 Lu CYC1m promoter S. cerevisiae TACATACAGTAGGATCCTA 64381 activate...
Showing: 121 - 140 of 254 results