We narrowed to 819 results for: cell

1. 6 Tips for Grant Writing

   Type

   Blog Post

   ...Cambridge University where he studied mechanisms of cell division. Recently Seán got the entrepreneurial ...research (either because of expertise, equipment, or excellence of the institution). Likewise, if you’re staying...

2. Transgenic Organisms, Cas9 Gene Drives, and Appropriate Safeguards

   Type

   Blog Post

   ...with appropriate flanking homology into a germline cell can create an RNA-guided gene drive. In principle...

3. Promoters

   Type

   Guide

   ...describes the specifics of these regions in eukaryotic cells. Core Promoter The core promoter region is located...bind. Histones are proteins found in eukaryotic cells that package DNA into nucleosomes. Histone binding...element controls the rate of transcription. Bacterial cells contain sigma factors which assist the RNA polymerase...ribosomal RNA (rRNA) which is a main component of a cell’s ribosome structure. Ribosomes are the site of protein...

4. Academic vs. Industry Postdocs

   Type

   Blog Post

   ...Scientist at AstraZeneca. She has a background in cell and developmental biology and is applying this towards...

5. Transferable Skills: Negotiation

   Type

   Blog Post

   ...request? Your colleague is if someone can feed their cells this weekend - why? Do they have an important plans...

6. Introducing Addgene's New Search - Find Plasmids More Easily For Your Research!

   Type

   Blog Post

   ...Promoters: Select the best promoter for your target cell type Serotype: Choose the AAV capsid or lentiviral...

7. Summer SciComm Series: Modes of Communication

   Type

   Blog Post

   ...compelling photos and videos, while molecular, micro, and cell biology are often more suited for cartoons or graphics...

8. Anatomy of a Plasmid Page at Addgene

   Type

   Blog Post

   ...such as some of our viral vectors, in NEB Stable cells. Resource information: This section contains information...analyzed using Addgene’s Analyze Sequence tool. Excellent, how can I check if the plasmid will be within...

9. Interview: Nicola Patron on Plant Synthetic Biology, MoClo, and More

   Type

   Blog Post

   ...really easy to clone genes for expression in plant cells. Sylvester and I chose the 96 most useful things...

10. Sequencing Primers

    Type

    Guide

    ...Murine stem cell virus, forward primer MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus, reverse...CCCTTGAACCTCCTCGTTCGACC (BD Biosciences) Murine stem cell virus, forward primer pBABE 5' CTTTATCCAGCCCTCAC...pLXSN 5' CCCTTGAACCTCCTCGTTCGACC (MSCV) Murine stem cell virus, same as MSCV, forward primer pMRB101-F AAGATGCAGGCAGCTGAGTT...