Skip to main content
Addgene

We narrowed to 14 results for: cell

Showing: 1 - 14 of 14 results
  1. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...-activated cell sorting (FACS) is used to sort cells expressing GFP and later, sorted cells are expanded...actively dividing cell types, whereas gamma-retroviruses can only infect mitotically active cell types. This...Using Packaging Cell Lines Gamma-retroviral vectors can be packaged using helper-free cell lines (Figure...-retroviral packaging cell line developed by Garry Nolan at Stanford. These cell lines contain gag-pol...and rat cells), or an amphotropic envelope, Phoenix-AMPHO (for the infection of mammalian cells). Using...make stable cell lines, VSV-G is often put under an inducible promoter. Depending on the cell type, there... — T and B cell transduction Murine Leukemia Virus (MuLV) and HIV glycoprotein — CD4+ cell transduction...
  2. Lentiviral Vector Guide

    Type
    Guide
    ...production cell line, typically human embryonic kidney 293T (HEK293T) cells. Standard HEK293T cells are sufficient...fluorescence-activated cell sorting (FACS) is used to sort cells expressing GFP and later expanded into a cell line. More...in a variety of cell types and models. Lentiviral vectors can target non-dividing cells, enable stable ...actively dividing cell types, whereas gamma-retroviruses can only infect mitotically active cell types. This...transfected into HEK293T cells using your preferred transfection method. The HEK293T cells will produce the viral...make stable cell lines, VSV-G is often put under an inducible promoter. Depending on the cell type, there...clinical tools. Stable Cell Lines Lentiviral vectors can be used to make stable cell lines due to their integration...
  3. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...based on other human cell lines, such as HeLa and A549 cells, and even insect Sf9 cells , have also been ...able to infect cells and replicate autonomously. Human embryonic kidney 293T (HEK293T) cells are the most...HEK293T cells are then extracted and purified for their use as viral vectors to deliver genes to cells in ...persist in non-dividing cells for a period of years without damaging the host cell. Episomal stability allows...broad range of cell types in vivo. AAV-DJ has been optimized further for specific cell and tissue types...co-delivered to the host cells. The full-length transgene is later reconstructed within the cell via different mechanisms...main cell body, or soma, towards the synapse at the axons. Blood-brain barrier (BBB) Layer of cells that...
  4. Plan Your Experiment

    Type
    Guide
    ...expressed in your target cells. For easy-to-transfect cell types (e.g. HEK293 cells), transfection with standard... CRISPR machinery. For more difficult cells (e.g. primary cells), viral delivery of CRISPR reagents may...identify and enrich positive cells, or selection marker to generate stable cell lines (for details, see Plasmids...wide variety of mammalian cell lines Useful for difficult to transfect cell types, can also be used in...possible genotypes within the resulting cell population. Some cells may be wild type due to either (1) a ...efficient target cleavage in cells expressing both Cas9 and gRNA. Edited cells may be homozygous or heterozygous...will use the example of CRISPR/Cas9 in mammalian cells, many of these principles apply to using CRISPR ...
  5. Antibody Guide

    Type
    Guide
    ... produced. Cells - Antibodies can also be produced in cell cultures using hybridomas, cell cultures created...created by fusing B cells with myeloma cells (immortalized B cells). The genetic reorganization that creates...identify and sort cells from a mixed population. Overview of application Collect cells from cell culture or ...specificity occurs in the B cell itself prior to antibody production; therefore, each B cell only produces one ... specific hybridoma cells into plasmids. Plasmids are then transfected into cells and induced to express...determines the isotype of the antibody. B cells, the immune cell responsible for producing antibodies, can...mature B cell can clone itself to enable higher production of a single antibody, but each B cell can only...
  6. Guide to Using Pooled Libraries

    Type
    Guide
    ...200x the number of cells as plasmids in the TKO library. Using large numbers of cells minimizes the effects...selection Most cells die or do not pass selection (in the case of a reporter) Sort “winning” cells Sequence ...library Apply selection; most cells will survive Perform NGS on the surviving cells Compare NGS results between...identify those cells that do not survive the selection mechanism. You’ll infect two sets of cells and subject...libraries, plasmid DNA can be delivered directly to the cells of interest. With others, notably pooled lentiviral...subsequently used to deliver the plasmids to the cells of interest. In either case, next-generation sequencing...Pooled Library Screens In pooled library screens, cells are infected at a very low multiplicity of infection...
  7. Adenovirus Guide

    Type
    Guide
    ...enters the host cell, and encode proteins necessary for viral DNA replication and host cell manipulation....expressed by the packaging cell line, normally the human embryonic kidney 293 (HEK293) cell line. There is a rare...transformed into AdEasier-1 cells (Addgene #16399) , which are BJ5183 E. coli cells containing pAdEasy. pAdEasy... construct flanked by ITRs. Cells from the packaging HEK293 or HER911 cell lines expressing E1 are transfected...HER911 cells throughout viral vector production. During experiments, GFP can be used to sort cells infected...transfected into HER911 E4+ cells for rAdV vector production, as HEK293 cells do not contain E4. Download...immune cells and antibody production that develops after exposure to an antigen. AdEasier-1 cells BJ5183...
  8. CRISPR Guide

    Type
    Guide
    ...with Haploid Embryonic Stem Cells Carrying a Guide RNA Library. Cell Stem Cell . 17 (2), 221–232. PMID: ...in the same cell. This is called multiplexing , and increases the likelihood that any cell containing ...can increase efficiency. Synchronizing cells or modulating the cell cycle can help as HDR takes place during...expressing stable cell line. After applying your screening conditions to your transduced cell population, you...tracking of RNA in live cells, including orthogonal RNA/DNA labeling in the same cell. Figure 11: Overview...promiscuity is unique to bacterial cells and does not occur in mammalian cells. SHERLOCK , developed by the ...genomic loci in living human cells by an optimized CRISPR/CAS system. Cell . 155 (7), 1479–1491. PMID: ...
  9. Molecular Biology Reference

    Type
    Guide
    ...daughter cells. These daughter cells contain the same genetic information as the parental cell, and are...with the host cell. Like the bacterial chromosomal DNA, plasmid DNA is replicated upon cell division, and...and each daughter cell receives at least one copy of the plasmid. By the 1970s the combined discoveries...are thus termed clones of the original cell. The plasmid DNA is similarly referred to as cloned DNA, and... and ideally would replicate these plasmids upon cell division in addition to their own genomic DNA. Because...additional replication burden, the rate of bacterial cell division is reduced (i.e., it takes more time to...against the propagation of these plasmids through cell division. To ensure the retention of plasmid DNA...
  10. Chemogenetics Guide

    Type
    Guide
    ...Human Stem Cell-Derived Neurons Repair Circuits and Restore Neural Function. Cell Stem Cell. 28:112-126...targeted to specific tissues, cell types or even subcellular regions of a neuron. Cell-specific expression of...actuators for specific cellular pathways, receptors, or ion channels targeted to specific cell populations (most...signaling, therefore allowing precise control over the cell population they are targeted to. To find chemogenetics...coupled receptors, or GPCRs. The largest class of cell surface receptors, GPCRs are seven-pass transmembrane...Common promoters in chemogenetics plasmids Promoter Cell Specificity hSyn1, CaMKIIa Neurons GFAP Glia CD68... AAV-delivered constructs can be controlled with cell-type specific promoters. Table 4 lists some common...
  11. Optogenetics Guide

    Type
    Guide
    ...subpopulation of cells within the injection site of the viral vector, rather than in all cells. For example...2010 Molecular and cellular approaches for diversifying and extending optogenetics. Cell. 196:1-28. PMID ...and genetic engineering to measure and manipulate cells (frequently neurons) and their governing biomolecular...detect, measure, and control molecular signals and cells in order to understand their functions. Example ...wavelength, the pore opens, cations flow into the cell (yellow dots), and the neuron is activated. Optogenetics...which conducts the flow of ions into or out of the cell. Scientists have identified a variety of naturally...adding trafficking signals to localize opsins to the cell membrane. Microbial opsins, such as those described...
  12. Science Guides

    Type
    Guide
    ...receptors to selectively control and investigate cell signaling pathways. Receptors are remotely controlled...and genetic engineering to measure and manipulate cells (frequently neurons) and their governing biomolecular...detect, measure, and control molecular signals and cells in order to understand their functions. Read More...
  13. Promoters

    Type
    Guide
    ...describes the specifics of these regions in eukaryotic cells. Core Promoter The core promoter region is located...bind. Histones are proteins found in eukaryotic cells that package DNA into nucleosomes. Histone binding...element controls the rate of transcription. Bacterial cells contain sigma factors which assist the RNA polymerase...ribosomal RNA (rRNA) which is a main component of a cell’s ribosome structure. Ribosomes are the site of protein...
  14. Sequencing Primers

    Type
    Guide
    ...Murine stem cell virus, forward primer MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus, reverse...CCCTTGAACCTCCTCGTTCGACC (BD Biosciences) Murine stem cell virus, forward primer pBABE 5' CTTTATCCAGCCCTCAC...pLXSN 5' CCCTTGAACCTCCTCGTTCGACC (MSCV) Murine stem cell virus, same as MSCV, forward primer pMRB101-F AAGATGCAGGCAGCTGAGTT...
Showing: 1 - 14 of 14 results