Skip to main content
Addgene
Showing: 1 - 14 of 14 results
  1. Plan Your Experiment

    Type
    Guide
    ...expressed in your target cells. For easy-to-transfect cell types (e.g. HEK293 cells), transfection with standard... CRISPR machinery. For more difficult cells (e.g. primary cells), viral delivery of CRISPR reagents may...identify and enrich positive cells, or selection marker to generate stable cell lines (for details, see Plasmids...wide variety of mammalian cell lines Useful for difficult to transfect cell types, can also be used in...possible genotypes within the resulting cell population. Some cells may be wild type due to either (1) a ...efficient target cleavage in cells expressing both Cas9 and gRNA. Edited cells may be homozygous or heterozygous...will use the example of CRISPR/Cas9 in mammalian cells, many of these principles apply to using CRISPR ...
  2. Guide to Using Pooled Libraries

    Type
    Guide
    ...200x the number of cells as plasmids in the TKO library. Using large numbers of cells minimizes the effects...selection Most cells die or do not pass selection (in the case of a reporter) Sort “winning” cells Sequence ...library Apply selection; most cells will survive Perform NGS on the surviving cells Compare NGS results between...identify those cells that do not survive the selection mechanism. You’ll infect two sets of cells and subject...libraries, plasmid DNA can be delivered directly to the cells of interest. With others, notably pooled lentiviral...subsequently used to deliver the plasmids to the cells of interest. In either case, next-generation sequencing...Pooled Library Screens In pooled library screens, cells are infected at a very low multiplicity of infection...
  3. Antibody Guide

    Type
    Guide
    ... produced. Cells - Antibodies can also be produced in cell cultures using hybridomas, cell cultures created...created by fusing B cells with myeloma cells (immortalized B cells). The genetic reorganization that creates...identify and sort cells from a mixed population. Overview of application Collect cells from cell culture or ...specificity occurs in the B cell itself prior to antibody production; therefore, each B cell only produces one ... specific hybridoma cells into plasmids. Plasmids are then transfected into cells and induced to express...determines the isotype of the antibody. B cells, the immune cell responsible for producing antibodies, can...mature B cell can clone itself to enable higher production of a single antibody, but each B cell can only...
  4. Adenovirus Guide

    Type
    Guide
    ...AdEasier-1 cells BJ5183 E. coli cells containing the pAdEasy-1 packaging plasmid 911E4 cells Cell line compatible...then transformed into AdEasier-1 cells , which are BJ5183 E. coli cells containing pAdEasy™. pAdEasy™ is... 293/911 cells throughout virus production. During experiments, GFP can be used to sort cells infected...must be transfected into 911E4 cells for virus production, as 293 cells do not contain E4. Adenovirus ...the Coxsackie-Adenovirus Receptor (CAR) to enter cells. Recombinant adenovirus has two genes deleted: E1...linear dsDNA construct flanked by ITRs. 293 or 911 cells are transfected with the linearized construct, and...about AAV, read our AAV guide . Can I make a stable cell line with adenovirus? No, adenoviral vectors can...
  5. Retrovirus Guide

    Type
    Guide
    ...packaging cell line. γ-retroviruses can transduce target cells, but the transduced target cell does not...using helper-free packaging cell lines This method utilizes a packaging cell line that stably expresses... packaging cell line. For example, Phoenix, a second generation γ-retrovirus packaging cell line developed...and rat cells), or an amphotropic envelope, Phoenix-AMPHO (for the infection of mammalian cells.) Using...transduce both dividing and non-dividing cells because once in the host cell cytoplasm, the viral componentes ...γ-retroviruses (gamma-retroviruses) in cancer and stem cell research has prompted the development of multiple...Moloney Murine Leukemia Virus) or MSCV (Murine Stem Cell Virus) sequences. Packaging genes (viral Gag-Pol...
  6. Lentiviral Guide

    Type
    Guide
    ...can use FACS to sort cells expressing GFP and later expand these cells into a cell line. Where does lentivirus...actively dividing cell types whereas standard retroviruses can only infect mitotically active cell types. This... necessary. What cell line should be used in order to produce lentivirus? 293T cells are usually used ...be used to make stable cell lines? Lentiviruses can be used to make stable cell lines in the same manner...infected host cells. When these antibiotics are added to the growth medium of the host cells, they kill ...kill off any cells that have not incorporated the lentiviral genome and those cells that survive can be expanded...plasmids are generalized and appropriate for varied cell types and systems. When planning your experiment...
  7. CRISPR Guide

    Type
    Guide
    ...with Haploid Embryonic Stem Cells Carrying a Guide RNA Library. Cell Stem Cell . 17 (2), 221–232. PMID: ...in the same cell. This is called multiplexing , and increases the likelihood that any cell containing ...can increase efficiency. Synchronizing cells or modulating the cell cycle can help as HDR takes place during...expressing stable cell line. After applying your screening conditions to your transduced cell population, you...tracking of RNA in live cells, including orthogonal RNA/DNA labeling in the same cell. Figure 11: Overview...promiscuity is unique to bacterial cells and does not occur in mammalian cells. SHERLOCK , developed by the ...genomic loci in living human cells by an optimized CRISPR/CAS system. Cell . 155 (7), 1479–1491. PMID: ...
  8. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...persist in non-dividing cells for a period of years without damaging the host cell. In contrast, viral particles...through cell lysis. Episomal stability enables long-term transgene expression in non-dividing cells and is... the helper plasmid are transfected into HEK293 cells, which contain the adenovirus gene E1+, to produce...serotypes differ in their tropism, or the types of cells they infect, making AAV a very useful system for...for preferentially transducing specific cell types. The chart below gives a summary of the tropism of AAV...AAV5, AAV6, AAV9 Pancreas AAV6, AAV8 Photoreceptor Cells AAV2, AAV5, AAV8 RPE (Retinal Pigment Epithelium...displays very high infectivity across a broad range of cell types. The mutant AAV-DJ8 displays the properties...
  9. Molecular Biology Reference

    Type
    Guide
    ...daughter cells. These daughter cells contain the same genetic information as the parental cell, and are...with the host cell. Like the bacterial chromosomal DNA, plasmid DNA is replicated upon cell division, and...and each daughter cell receives at least one copy of the plasmid. By the 1970s the combined discoveries...are thus termed clones of the original cell. The plasmid DNA is similarly referred to as cloned DNA, and... and ideally would replicate these plasmids upon cell division in addition to their own genomic DNA. Because...additional replication burden, the rate of bacterial cell division is reduced (i.e., it takes more time to...against the propagation of these plasmids through cell division. To ensure the retention of plasmid DNA...
  10. Chemogenetics Guide

    Type
    Guide
    ...Human Stem Cell-Derived Neurons Repair Circuits and Restore Neural Function. Cell Stem Cell. 28:112-126...targeted to specific tissues, cell types or even subcellular regions of a neuron. Cell-specific expression of...actuators for specific cellular pathways, receptors, or ion channels targeted to specific cell populations (most...signaling, therefore allowing precise control over the cell population they are targeted to. To find chemogenetics...coupled receptors, or GPCRs. The largest class of cell surface receptors, GPCRs are seven-pass transmembrane...Common promoters in chemogenetics plasmids Promoter Cell Specificity hSyn1, CaMKIIa Neurons GFAP Glia CD68... AAV-delivered constructs can be controlled with cell-type specific promoters. Table 4 lists some common...
  11. Optogenetics Guide

    Type
    Guide
    ...subpopulation of cells within the injection site of the viral vector, rather than in all cells. For example...2010 Molecular and cellular approaches for diversifying and extending optogenetics. Cell. 196:1-28. PMID ...and genetic engineering to measure and manipulate cells (frequently neurons) and their governing biomolecular...detect, measure, and control molecular signals and cells in order to understand their functions. Example ...wavelength, the pore opens, cations flow into the cell (yellow dots), and the neuron is activated. Optogenetics...which conducts the flow of ions into or out of the cell. Scientists have identified a variety of naturally...adding trafficking signals to localize opsins to the cell membrane. Microbial opsins, such as those described...
  12. Science Guides

    Type
    Guide
    ...receptors to selectively control and investigate cell signaling pathways. Receptors are remotely controlled...and genetic engineering to measure and manipulate cells (frequently neurons) and their governing biomolecular...detect, measure, and control molecular signals and cells in order to understand their functions. Read More...
  13. Promoters

    Type
    Guide
    ...describes the specifics of these regions in eukaryotic cells. Core Promoter The core promoter region is located...bind. Histones are proteins found in eukaryotic cells that package DNA into nucleosomes. Histone binding...element controls the rate of transcription. Bacterial cells contain sigma factors which assist the RNA polymerase...ribosomal RNA (rRNA) which is a main component of a cell’s ribosome structure. Ribosomes are the site of protein...
  14. Sequencing Primers

    Type
    Guide
    ...Murine stem cell virus, forward primer MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus, reverse...CCCTTGAACCTCCTCGTTCGACC (BD Biosciences) Murine stem cell virus, forward primer pBABE 5' CTTTATCCAGCCCTCAC...pLXSN 5' CCCTTGAACCTCCTCGTTCGACC (MSCV) Murine stem cell virus, same as MSCV, forward primer pMRB101-F AAGATGCAGGCAGCTGAGTT...
Showing: 1 - 14 of 14 results