We narrowed to 813 results for: cell

...receptors to selectively control and investigate cell signaling pathways. Receptors are remotely controlled...and genetic engineering to measure and manipulate cells (frequently neurons) and their governing biomolecular...detect, measure, and control molecular signals and cells in order to understand their functions. Read More...

...CCCTTGAACCTCCTCGTTCGACC Murine stem cell virus Forward MSCV Reverse CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus Reverse ...CCCTTGAACCTCCTCGTTCGACC Murine stem cell virus Forward MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus Reverse MT1...pLXSN 5' (MSCV) CCCTTGAACCTCCTCGTTCGACC Murine stem cell virus, same as MSCV Forward pMRB101-F AAGATGCAGGCAGCTGAGTT...

...element controls the rate of transcription. Bacterial cells contain sigma factors that assist the RNA polymerase...other promoters can drive expression in specific cells or under different conditions. Promoter Expression...ribosomal RNA (rRNA), which is a main component of a cell’s ribosome structure. Ribosomes are the site of protein...

...assembly of cellular circuits using Golden Gate-based cloning methods for use in mammalian cells. These can...MoClo Yeast Toolkit (YTK) to optimize secretion and cell surface display of proteins of interest. Yeast Secrete... create multigene constructs expressed in the cellulose-producing Komagataeibacter species. Ralstonia-...

...homology. While this approach doesn't work in other cell types, it can be a major time- and cost-saver for...

...Mitogen-activated protein kinases (MAPKs), also known as extracellular signal-regulated kinases (ERKs), are serine/...threonine-specific protein kinases. They regulate diverse cellular programs by acting as an integration point for...

...Note: (Link opens in a new window) Primer3 is an excellent resource for choosing primers. Place thin-walled...

...catalog that target epitope tags and other common cellular proteins. These ready-to-use recombinant monoclonal...

...species (e.g., human, watermelon, Streptomyces ) Subcellular compartment (chloroplastic, cytoplasmic, glyoxysomal...

...Sensing and Signaling Browse plasmids related to intercellular signaling and environmental sensing. Strains...