We narrowed to 347 results for: ATC
-
TypeBlog Post....org Find lab protocols on the Addgene website Watch Addgene's video collection ...
-
Deck the Lab 2022!
TypeBlog Post...it next to our lab trash (which coincidentally matches our Christmas tree's RGB colors) 😅🎅🤶🎄👨🔬👩... -
Podcast: A Malawian Professor's Path to Biotech Research
TypeBlog Post...Univeristy of Agriculture and Natural Resources Watch Dr. Kwapata's Speech at Seeding Lab's Positively... -
Summer Fun at Addgene!
TypeBlog Post... you to head on over to our YouTube channel and watch it now! (Bonus: Tim kindly offered to finishing ... -
Newly Updated AAV Data Hub!
TypeBlog Post...that you can even see dendritic spines! Curious? Watch our AAV Data Hub Challenge recording to see two ... -
Editor's Choice, October 2016
TypeBlog Post...fantastic posts in October. Click on the links below to catch up on ways to use CRISPR in plants, to learn techniques... -
Grad School Advice Part 2: Building Community
TypeBlog Post...work can be found here: https://www.youtube.com/watch?v=lQGAsgjjBDI&feature=youtu.be. 8:17 - 11:10 : The... -
Michael Koeris' Journey from Grad Student to Entrepreneur: The Story of Sample 6
TypeBlog Post...the Addgene Board of Directors. We're excited to watch both Addgene and Sample 6 grow with his help! Special... -
Sequencing Primers
TypeGuide...35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter, forward primer AC5 ACACAAAGCCGCTCCATCAG (Invitrogen...primer LacI-R GGCATACTCTGCGACATCGT 5' end of LacI, reverse primer LacZ-R GACAGTATCGGCCTCAGGAA 5' end of LacZ... pBluescriptKS TCGAGGTCGACGGTATC For pBluescript vector pBluescriptSK TCTAGAACTAGTGGATC For pBluescript...pBR322ori-F GGGAAACGCCTGGTATCTTT pBRS322 origin, forward primer pBRforBam CTTGGAGCCACTATCGAC In pBR322 ... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward... stem cell virus, forward primer pBABE 5' CTTTATCCAGCCCTCAC (Weinberg Lab) Psi packaging signal, 5' of...List Primer Sequence & Description 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1... -
Management for Scientists: Seeking Feedback
TypeBlog Post...this valuable input from at least some employees. Watch out for "information allies" – these are employees... -
Six Spooky Science Stories and Halloween at Addgene
TypeBlog Post...to female. Then, it detaches from the gills and latches onto the base of the tongue where it pierces the... -
Phage Directory: From Phage Therapy to a Repository of Phage Information
TypeBlog Post...non-lysogenic phage URGENTLY to find suitable phage matches. Email [email protected] if you can help! — Dr... -
Searchable and Sortable gRNAs for Your Next CRISPR Experiment
TypeBlog Post...How to Design Your gRNA Use the CRISPR Software Matchmaker Browse Alll of Our CRISPR Posts Additional Resources... -
CRISPR Protocol for Genomic Deletions in Mammalian Cell Lines [Video]
TypeBlog Post...create, and examine novel genetic configurations. Watch the following video to learn Daniel and Matthew'... -
Inside Addgene's 10 Year Anniversary Gala
TypeBlog Post...guys, Blugene here! As Addgene’s mascot, I’ve watched Addgene grow into the successful, internationally... -
Same Addgene, New Look - Why We Redesigned Our Homepage & Mascot
TypeBlog Post...social media, we wanted to make sure our friend matched our core branding. Blugene needs to be friendly... -
New Norepinephrine Indicators: nLightG and nLightR
TypeBlog Post...and nLightR, and may soon have a red tool which matches the sensitivity of nLightG. Many thanks to Mike... -
Scientific Sharing in the Time of COVID-19: Databases and Resources
TypeBlog Post... The team behind Crowdfight COVID-19 strives to match up scientists across fields with different technical... -
A Better Way to Get Customer Support: The Help Center
TypeBlog Post...not! One of our core values here is to provide unmatched customer support, as this is vital to ensuring... -
Mapping the 4D nucleome with CRISPR/Cas9
TypeBlog Post...been adapted to fluorescently label a sequence matching its gRNA, facilitating the live study of chromatin...