Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of Addgene plasmid sequence databases.

In Category

We narrowed to 347 results for: ATC

Showing: 141 - 160 of 347 results

  1. Deck the Lab 2022!

    Type
    Blog Post
    ...it next to our lab trash (which coincidentally matches our Christmas tree's RGB colors) 😅🎅🤶🎄👨‍🔬👩‍...

  4. Summer Fun at Addgene!

    Type
    Blog Post
    ... you to head on over to our YouTube channel and watch it now! (Bonus: Tim kindly offered to finishing ...

  5. Editor's Choice, October 2016

    Type
    Blog Post
    ...fantastic posts in October. Click on the links below to catch up on ways to use CRISPR in plants, to learn techniques...

  6. Newly Updated AAV Data Hub!

    Type
    Blog Post
    ...that you can even see dendritic spines!  Curious? Watch our AAV Data Hub Challenge recording to see two ...

  9. Sequencing Primers

    Type
    Guide
    ...35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter, forward primer AC5 ACACAAAGCCGCTCCATCAG (Invitrogen...primer LacI-R GGCATACTCTGCGACATCGT 5' end of LacI, reverse primer LacZ-R GACAGTATCGGCCTCAGGAA 5' end of LacZ... pBluescriptKS TCGAGGTCGACGGTATC For pBluescript vector pBluescriptSK TCTAGAACTAGTGGATC For pBluescript...pBR322ori-F GGGAAACGCCTGGTATCTTT pBRS322 origin, forward primer pBRforBam CTTGGAGCCACTATCGAC In pBR322 ... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward... stem cell virus, forward primer pBABE 5' CTTTATCCAGCCCTCAC (Weinberg Lab) Psi packaging signal, 5' of... forward primer Full Primer List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1...
Showing: 141 - 160 of 347 results