We narrowed to 225 results for: GFP

...using a reporter vector to tag YGOI with lacZ and/or GFP (e.g. pPD80_08) and following the expression pattern...

... Resistance Purpose PI 17446 pLenti CMV GFP Hygro (656-4) GFP Hygromycin 3rd gen lentiviral eGFP expression...H840A) none Expresses dCAS9-VP64 activator with 2A GFP Feng Zhang 61425 lenti dCAS-VP64_Blast dCAS9 (D10A...

...AAV1). AAV Vectors for Serotype Testing pAAV-CAG-GFP (Plasmid #37825) Description : Ready-to-use AAV in...plasmid 37825 (deposited by Edward Boyden ) and direct GFP expression from the CAG promoter. For information...

...activator with 2A GFP 61423 : Expresses the MS2-P65-HSF1 activator helper complex with 2A GFP 61424 : sgRNA...(SapI)_hSyn-GFP-KASH-bGH (SpGuide acceptor). This is a AAV plasmid for sgRNA cloning. GFP-KASH fusion ...PX552; U6 promoter-driven; for sgRNA cloning; has GFP-KASH for FACS sorting SaCas9 + single guide RNA: ...

...David Nemazee 161030 Zhou-pLOV-GFP-Luc Lentiviral vector expressing GFP and luciferase for use as a reporter...

...199419 Anti-GFP [N86/38R-2b] GFP Aequorea victoria Mouse IgG2b 199420 Anti-GFP [N86/8R-2b] GFP Aequorea ...206719 Anti-GFP [N86/38R-1] GFP Aequorea victoria Mouse IgG2a 206720 Anti-GFP [N86/8R-1] GFP Aequorea victoria...Rat Mouse 206743 GFP scFv [N86/44] N86/44 scFv GFP Aequorea victoria Mouse 206744 GFP scFv [N86/20] N86...short and long Rat Mouse IgG2a 114492 Anti-GFP [N86/38.1R] GFP Aequorea victoria Mouse IgG2a 114493 Anti-NGL...glutamate receptor Rat Mouse IgG2a 177572 Anti-GFP [N86/8R] GFP Aequorea victoria Mouse IgG2a 177573 Anti-...N479/107R] VAPA/B Mouse IgG2a 188164 Anti-GFP [N86/44R] GFP Aequorea victoria Mouse IgG2a 188165 Anti-.../22R] Prrt2 Mouse Mouse IgG2a 188166 Anti-GFP [N86/20R] GFP Aequorea victoria Mouse IgG2a 188167 Anti-...

...serotypes. This collection is now complete! pAAV-CAG-GFP (plasmid 37825) and pAAV-hSyn-EGFP (plasmid 50465...

...fluorescent protein topics page Get the basics on GFP Find microbiology blog posts Resources on Addgene.org...

...via phosphorylation, promoting transcription of a GFP reporter. Subsequent exposure to red light rapidly...

...Neuronal stem cells transduced with iTOP resulting in GFP expression. Image courtesy of Diego D'Astolfo. ...

...destination vector contains GFP, enabling you to select cells with high GFP expression. These cells have...

...comprehensive comparison to GFP, please refer to NEB's comparison of SNAP-tag, CLIP-tag, and GFP . Technology SNAP-tag...

...library comes either with or without mCherry and GFP fluorescent controls. Alternatively, you can order...

...the viral protease, Nsp5. Our set also includes a GFP construct as a control. For easier portability, all...

...selection cassette. They could also switch from FLAG to GFP or a different epitope. Addgene: Do you have any ...

...be another method to assess transfection success. GFP is often used as a reporter and we will be covering...

...activation domain Forward GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP Forward GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...CCATCTAATTCAACAAGAATTGGGACAAC 5' end of GFP Reverse GPDpro-F CGGTAGGTATTGATTGTAATTCTG S. cerevisiae GPD promoter Forward GW...

... 52536 rAAV-CAG::FLEX-rev:: hM4D-2a-GFP hM4D(Gi) - Inhibition GFP Cre-dependent 1 Scott Sternson 228902...

...high concentration. Proteins that are derived from GFP and contain the A206K mutation are monomeric at all...AcGFP1-C1 - Mammalian Expression sfGFP (superfolder GFP) 485 507 54 14 min Prone to dimerization sfGFP-N1...dimerization pcDNA3-EGFP - Mammalian Expression pCAG-GFP - Mammalian Expression pLV-eGFP - Mammalian Lentiviral...Brightness pKa Maturation Structure Plasmids Free Use GFP (fuGFP) 395 503 Monomer pUS252 - Mammalian Expression...Expression mPA-Emerald-C1 - Mammalian Expression PA-GFP 504 517 400 14 Monomer (A206K) pPAGFP-N1 - Mammalian...Expression pRSETA-PAGFP - Bacterial Expression pFA6a-PA-GFP-kanMX6 - Yeast Expression pFA6a-link-yEPAGFP-CaUra3...

...cells in vivo, the non-immunogenic violet-excited GFP variant Vex. To understand the impact of this gene...