We narrowed to 259 results for: GFP
-
TypeBlog Post...destination vector contains GFP, enabling you to select cells with high GFP expression. These cells have...
-
Rinehart Lab Phosphoprotein Reagents
TypeCollection...68299 GFP E17TAG/Q157TAG Plasmid 68298 GFP S2TAG/E17TAG Plasmid 68297 GFP Q157TAG Plasmid 68296 GFP S2TAG...Library 111704 Mode #1 Library Plasmid 69118 E17TAG GFP zeo resistance Plasmid 68307 SupD Strain 68306 C321...S2TAG Plasmid 68295 GFP E17TAG Plasmid 68294 SepOTSν Plasmid 68292 SepOTSλ Plasmid 68291 SepOTSκ Plasmid... -
Lentivirus Plasmids
TypeCollection...Sabatini 171123 pLVX-TetOne-Puro-GFP 3rd Dox-inducible expression of GFP. Jason Sheltzer 20342 FUW-M2rtTA...hUbC-driven EGFP. Can be used for cDNA expression. David Baltimore 12247 pLVTHM 2nd EF-1a-driven GFP and shRNA...Brindle and Duncan Jodrell 17448 pLenti CMV GFP Puro (658-5) 3rd eGFP expression with CMV promoter and puromycin...expression of RFP as a reporter. See plasmid 17618 for GFP reporter. Linzhao Cheng 17452 pLenti CMV Puro DEST...more variants. Tyler Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP fusion with puromycin resistance. Can ...Stephen Elledge 21373 pHIV-EGFP 3rd EF-1alpha driven expression of cDNA and and EGFP co-expression. See plasmid...119816 pLentipuro3/TO/V5-GW/EGFP-Firefly Luciferase 3rd Expression of EGFP-Firefly luciferase fusion protein... -
Fluorescent Protein Travel Awards - Protein Variants, a Serotonin Sensor, and an Artificial Leaf Replica System
TypeBlog Post...fluorescent protein topics page Get the basics on GFP Find microbiology blog posts Resources on Addgene.org...variant library is monitored by fusing the variants to eGFP followed by an internal ribosomal entry site and...a variant has wild-type levels of abundance, the eGFP will be stable and fluoresce. But if the variant...unstable, it will be degraded, leading to reduced eGFP fluorescence. Cells expressing the library are then...fluorescence-activated cell sorting into four bins based on their eGFP:mCherry ratios. Genomic DNA from each bin are then extracted... -
Multiplexed Overexpression of Regulatory Factors (MORF) collection
TypeBlog Post...library comes either with or without mCherry and GFP fluorescent controls. Alternatively, you can order... -
Scientists Map the SARS-CoV-2-Human Interaction Network
TypeBlog Post...the viral protease, Nsp5. Our set also includes a GFP construct as a control. For easier portability, all... -
Synthetic Photobiology: Optogenetics for E. coli
TypeBlog Post...via phosphorylation, promoting transcription of a GFP reporter. Subsequent exposure to red light rapidly... -
Plasmids 101: Mammalian Vectors
TypeBlog Post...be another method to assess transfection success. GFP is often used as a reporter and we will be covering... -
Viral Production
TypeCollection... later, Cre-dependent GFP expression was detected with direct fluorescence. GFP was not detected in the...viral genomes (vg)/cell, pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] (Addgene 84445-AAVrg) alone at 1.1E6 vg/mL, ... prep # 55632-AAVrg). pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] was a gift from Edward Boyden (Addgene viral... -
Hot Plasmids - June 2019 - Optogenetics, Acoustic Reporter Genes, microRNAs, and the CRISPR-Cas9 system CHIME
TypeBlog Post...cells in vivo, the non-immunogenic violet-excited GFP variant Vex. To understand the impact of this gene... -
Protein Tagging with CRISPR/Cas9: A Conversation with Mendenhall and Myers
TypeBlog Post...selection cassette. They could also switch from FLAG to GFP or a different epitope. Addgene: Do you have any ... -
Lentiviral Prep Service
TypeCollection...Purpose PI 17446 pLenti CMV GFP Hygro (656-4) GFP Hygromycin 3rd gen lentiviral eGFP expression vector, CMV... 61422 dCAS9-VP64_GFP dCAS9 (D10A, H840A) none Expresses dCAS9-VP64 activator with 2A GFP Zhang 61425 ...analysis of clonal dynamics. This library expresses EGFP for easy visualization via direct fluorescence. ... -
CRISPR/Cas9 FAQs Answered!
TypeBlog Post...experiment, consider co-transfecting with GFP. This allows you to sort for GFP-positive cells and to enrich for... -
Lighting Up Cell Signaling with Photoswitchable Kinases
TypeBlog Post...Expression with Cre-lox Control Protein Activity with GFP Resources at Addgene.org Find KTR reporter plasmids... -
Viral Vectors 101: Virus Safety
TypeBlog Post... for a researcher to come into contact with than GFP. Similarly, if the viral vector carries an shRNA ... -
Viral Vectors 101: Calcium Sensors
TypeBlog Post...ones? Many of the available biosensors use a single GFP or CFP/YFP-derived FRET pair. If you need to free... -
Announcing the Winners of the 2021 Michael Davidson and Roger Tsien Commemorative Conference Awards
TypeBlog Post...line, Hep3B. From left to right: Mitotracker Red, GFP for the biosensor, Hoechst, and overlay). ...(DKFZ) who has developed new redox sensitive GFP2 (roGFP2)-based biosensors for live cells. His work focuses..., Pedre Pérez’s biosensor fuses MPST to roGFP2. Because roGFP2 contains two cysteines near the chromophore...the MPST hydrosulfide can be transferred to the roGFP2 cysteine thiols and change its fluorescence properties... -
Validated gRNA Sequences
TypeCollection...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes...GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes 24825012 Sibley GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA...Christiaen EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria...24336571 Zhang EGFP A. victoria GAGCTGGACGGCGACGTAAA 51761 cut S. pyogenes 24336571 Zhang EGFP A. victoria... -
Serotype Testing AAV
TypeCollection...AAV1). AAV Vectors for Serotype Testing pAAV-CAG-GFP (Plasmid #37825) Description : Ready-to-use AAV in...plasmid 37825 (deposited by Edward Boyden ) and direct GFP expression from the CAG promoter. For information... available from Addgene's viral service. Control EGFP vectors in various serotypes for serotype testing... 37825-AAVrg.T 20 µL $ 150 Add to Cart pAAV-hSyn-EGFP (Plasmid #50465) Description : Ready-to-use AAV ...plasmid 50465 (deposited by Bryan Roth ) and direct EGFP expression from the human synpasin promoter. For... -
Split-BioID: An Improved Method for Studying Protein-Protein Interactions
TypeBlog Post... enriched relative to controls using Split-BioID-GFP and BioID run on six unrelated proteins. One caveat...