Skip to main content

We narrowed to 54 results for: GFP

Showing: 1 - 20 of 54 results
  1. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... PINK1 N-GFP PINK1 GFP CMV Parkinson's Mark Cookson 13316 pcDNA-DEST47 PINK1 C-GFP PINK1 GFP CMV Parkinson's...21190 GFP-pcDNA3-PKCgamma-cys1Acys1B PRKCG GFP CMV Spinocerebellar ataxia 27 Tobias Meyer 21204 GFP-N2-PKCgamma...PKCgamma PRKCG GFP CMV Spinocerebellar ataxia 26 Tobias Meyer 21205 GFP-C1-PKCgamma-C1A PRKCG GFP CMV Spinocerebellar...-HtrA2-EGFP HTRA2 GFP CMV Parkinson's L. Miguel Martins 14122 pcDNA3-HtrA2-EGFP S306A HTRA2 GFP CMV Parkinson's... GPD 25QDProGFP p416 HTT GFP GPD Huntington's Susan Lindquist 15569 GPD 104QDProGFP p416 HTT GFP GPD Huntington's...GAL 25Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15581 GAL 46Q+ProGFPp416 HTT GFP GAL1 Huntington's...GAL 72Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15583 GAL 103Q+ProGFPp416 HTT GFP GAL1 Huntington's...
  2. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ... Gerlich 25999 LV-GFP Chromatin H2B GFP Elaine Fuchs 11680 H2B-GFP Chromatin H2B GFP Geoff Wahl 21210 ...61803 GFP-Rab7A Late endosomes Rab7a AcGFP Gia Voeltz 12605 GFP-rab7 WT Late endosomes RAB7 GFP Richard...Gadella 50057 pLYS1-FLAG-MitoGFP-HA Mitochondria MCU GFP Vamsi Mootha 49153 GFP-Mff Mitochondria-Outer ...89472 GFP-hChibby1 Mother Centrioles / Ciliary Base Chibby1 GFP Ken-Ichi Takemaru 89770 pLenti-EGFP-hChibby1...Filaments beta-actin EGFP Robert Singer 27382 pDEST/N1-hEB1-GFP Microtubules EB1 GFP Robin Shaw 40908 pDEST...Beta-catenin GFP Adherens Junctions Beta-catenin EGFP Alpha Yap 67937 mouse E-cadherin GFP (423) Adherens...38277 pMXs-puro GFP-p62 Autophagosome Sequestosome-1 EGFP Noboru Mizushima 38272 pMXs-IP GFP-WIPI-1 Autophagosome...
  3. Control AAV Preps

    Type
    Collection
    ...CAG-NLS-GFP CAG NLS-GFP Constitutive PHPeB Viviana Gradinaru 116869 pAAV-CAG-H2B-GFP CAG H2B-GFP Constitutive...Fluorophore/Tag Activity Serotype PI 37825 AAV-CAG-GFP CAG GFP Constitutive 1, 2, 5, 6, 8, 9, 11, rg*, PHPeB...PHP.eB, PHP.S Edward Boyden 83900 pAAV-mDlx-GFP-Fishell-1 Dlx GFP Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB ...Constitutive 1 Kiryl Piatkevich 214147 pAAV-hIBA1a-GFP-miR124T hIBA1a GFP Constitutive 5 Chun-Li Zhang 20299 pAAV-EF1a-double... Viviana Gradinaru 83895 pAAV-hDlx-Flex-GFP-Fishell_6 Dlx GFP Cre dependent 1, 2, 8, 9, rg* Gordon Fishell..., 9, rg* Karl Deisseroth 122100 pAAV-EF1α1.1-GFP EF1a GFP Constitutive 2 Edward Boyden 128434 pAAV-Ef1a-fDIO-tdTomato...Jordane Dimidschstein 135631 pAAV-S5E2-GFP-fGFP E2 regulatory EGFP Constitutive 1, 9, PHP.eB Jordane Dimidschstein...
  4. Brain Initiative Collection

    Type
    Collection
    ...Fishell 83895-AAV1 pAAV-hDlx-Flex-GFP-Fishell_6 Cre recombinase-dependent GFP expression in forebrain GABA-...Fishell 83895-AAV2 pAAV-hDlx-Flex-GFP-Fishell_6 Cre recombinase-dependent GFP expression in forebrain GABA-...Fishell 83895-AAV8 pAAV-hDlx-Flex-GFP-Fishell_6 Cre recombinase-dependent GFP expression in forebrain GABA-...Fishell 83895-AAV9 pAAV-hDlx-Flex-GFP-Fishell_6 Cre recombinase-dependent GFP expression in forebrain GABA-...Fishell 83895-AAVrg pAAV-hDlx-Flex-GFP-Fishell_6 Cre recombinase-dependent GFP expression in forebrain GABA-...element Gordon Fishell 83900-AAV1 pAAV-mDlx-GFP-Fishell-1 GFP expression in forebrain GABA-ergic interneurons...element Gordon Fishell 83900-AAV2 pAAV-mDlx-GFP-Fishell-1 GFP expression in forebrain GABA-ergic interneurons...
  5. Caltech Systemic Capsids

    Type
    Collection
    ...Dimidschstein 135631 pAAV-S5E2-GFP-fGFP E2 regulatory element GFP, membrane-targeted GFP Control Dimidschstein ...pAAV-CAG-GFP CAG GFP Control Boyden 50465 pAAV-hSyn-EGFP hSyn EGFP Control Roth 50469 pAAV-CaMKIIa-EGFP CamKIIa...104061 CAG-NLS-GFP CAG NLS-GFP Control Gradinaru 105530 pAAV.CMV.PI.EGFP.WPRE.bGH CMV EGFP Control Wilson...Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden MaCPNS2 These viral vector preparations...Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden CAP-B10 These viral vector preparations...Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden CAP-B22 These viral vector preparations...Promoter Description Category PI 37825 pAAV-CAG-GFP CAG GFP Control Boyden AAV9-X1.1 These viral vector preparations...
  6. Retrovirus Plasmids

    Type
    Collection
    ...Weinberg 10676 pMKO.1 GFP MoMLV U6-driven plasmid for shRNA expression with GFP expression. See plasmid...William Hahn 63704 pRetroX GFP T2A Cre CMV/MSV Tetracycline inducible expression of GFP T2A Cre fusion in mammalian...James Iglehart 20672 MSCV-IRES-GFP MSCV For transgene expression with a GFP marker. Tannishtha Reya 21654...puromycin or screen for GFP. David Bartel 32702 pMSCV-loxp-dsRed-loxp-eGFP-Puro-WPRE MSCV Conditional overexpression...21654 pMSCV PIG (Puro IRES GFP empty plasmid) MSCV For cloning and gene expression. Select with puromycin... pMIG MSCV Plasmid for transgene expression with GFP expression. See plasmid 12282 for the addition of...dsRed and the activation of the transgene fused to eGFP. Hans Clevers 18760 MSCV IRES Luciferase MSCV Plasmid...
  7. Optogenetics AAV Preps

    Type
    Collection
    ...pAAV-hsyn-Jaws-KGC-GFP-ER2 Syn Jaws GFP Constitutive 5, 8, rg* Edward Boyden 84445 pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2...Karl Deisseroth 58880 pAAV-Syn-ChR2(H134R)-GFP Syn ChR2/H134R GFP Constitutive 8, rg* Edward Boyden 100054...Gradinaru 107708 pAAV-hSynapsin- soCoChR-GFP Syn CoChR (soma-targeted) GFP Constitutive 9 Edward Boyden 107712...107712 pAAV-hSynapsin-FLEX-soCoChR-GFP Syn CoChR (soma-targeted) GFP Cre dependent 9 Edward Boyden 35505 ...Deisseroth 122063 pAAV-EF1α1.1-ChrimsonR-GFP EF1a ChrimsonR GFP Constitutive 2 Edward Boyden 124650 pAAV-CamKIIa-C1V1...Christopher Harvey 59170 pAAV-Syn-Chronos-GFP Syn Chronos GFP Constitutive 1, 5, rg* Edward Boyden 59171...Constitutive 8 Karl Deisseroth 22222 AAV-FLEX-Arch-GFP CAG Arch GFP Cre dependent 1, 9 Edward Boyden 28305 pAAV-FLEX-ArchT-tdTomato...
  8. Retrograde AAV viral preps

    Type
    Collection
    ...pAAV-mDlx-GFP-Fishell-1 Dlx GFP Control Gordon Fishell 83895 pAAV-hDlx-Flex-GFP-Fishell_6 Dlx GFP Control... 37825 AAV-CAG-GFP CAG GFP Control Edward Boyden 51502 AAV pCAG-FLEX-EGFP-WPRE CAG EGFP, Cre-dependent...105547 pENN.AAV.EF1a.eGFP.WPRE.rBG EF1a EGFP Control James M. Wilson 116869 pAAV-CAG-H2B-GFP CAG GFP Control...pAAV-Syn-ChR2(H134R)-GFP Syn Activator Optogenetics Edward Boyden 59170 pAAV-Syn-Chronos-GFP Syn Activator Optogenetics...pAAV-hsyn-Jaws-KGC-GFP-ER2 Syn Inhibitor Optogenetics Edward Boyden 84445 pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] CAG...Recombinases James M. Wilson 105551 pENN.AAV.CamKII.HI.GFP-Cre.WPRE.SV40 CamKII GFP-tagged Cre expression Recombinases...Optogenetics Edward Boyden 99039 pAAV-CamKII-ArchT-GFP (PV2527) CamKII Inhibitor Optogenetics Edward Boyden...
  9. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...expression vector GFP Varies pMKO.1 GFP - Retroviral shRNA expression pLenti CMV GFP DEST - ...Fluorescent proteins (GFP, mCherry, etc) Localization pcDNA3-EGFP - C-terminal GFP for mammalian expression...genome MSCV-IRES-GFP or pMSCV-IRES-mCherry FP - Mammalian retroviral gene expression with GFP or mCherry selectable...fusing your protein to another protein, such as GFP, which allows you to visualize the cellular localization... cells, integrate into host genome pLenti CMV GFP DEST - Lentiviral Gateway destination vector for ...PGKpuro2ABFP - For retroviral delivery of one sgRNA pMKO.1 GFP - Retroviral shRNA expression Retroviral backbones...stemloop 2 and EF1a-zeo resistance marker pLenti CMV/TO GFP-Zeo DEST (719-1) - 3rd gen lentiviral Gateway destination...
  10. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ... AAV-FLEX-Arch-GFP Optogenetics Ed Boyden AV-1-PV2527 99039-AAV1 pAAV-CamKII-ArchT-GFP (PV2527) Optogenetics...pAAV-CamKII-ArchT-GFP (PV2527) Optogenetics Ed Boyden AV-5-PV3446 59170-AAV5 pAAV-Syn-Chronos-GFP Optogenetics...pAAV-hsyn-Jaws-KGC-GFP-ER2 Optogenetics Ed Boyden AV-8-PV3638 65014-AAV8 pAAV-hsyn-Jaws-KGC-GFP-ER2 Optogenetics... AAV-FLEX-Arch-GFP Optogenetics Ed Boyden AV-9-PV2527 99039-AAV9 pAAV-CamKII-ArchT-GFP (PV2527) Optogenetics...29777-AAV5 pAAV-CAG-ArchT-GFP Ed Boyden AV-9-PV2509 29777-AAV9 pAAV-CAG-ArchT-GFP Ed Boyden AV-9-PV3446 59170...59170-AAV9 pAAV-Syn-Chronos-GFP Ed Boyden AV-1-PV3511 98926-AAV1 pAAV.CAG.GFPsm-myc.WPRE.SV40 Loren Looger...Ed Boyden AV-1-PV3446 59170-AAV1 pAAV-Syn-Chronos-GFP Optogenetics Ed Boyden AV-1-PV3447 59171-AAV1 pAAV-Syn-ChrimsonR-tdT...
  11. Adenovirus Plasmids

    Type
    Collection
    ...Bamburg 16407 pAdEasy 2-GFP beta-gal Test plasmid that contains β-gal and GFP and a ∼10 Kb genomic DNA...promoter Vogelstein 16404 pAdTrack For production of GFP-trackable viruses containing transgene under a chosen... Vogelstein 16405 pAdTrack-CMV For production of GFP-trackable viruses containing transgene under CMV ...
  12. Brain Armamentarium

    Type
    Collection
    ...James M. Wilson 37825-CAP-B10 pAAV-CAG-GFP AAV expression of GFP from the CAG promoter Edward Boyden Viviana...Viviana Gradinaru 37825-CAP-B22 pAAV-CAG-GFP AAV expression of GFP from the CAG promoter Edward Boyden Viviana... Gradinaru 37825-CAP-MaCPNS1 pAAV-CAG-GFP AAV expression of GFP from the CAG promoter Edward Boyden Viviana... Gradinaru 37825-CAP-MaCPNS2 pAAV-CAG-GFP AAV expression of GFP from the CAG promoter Edward Boyden Viviana...Tasic Melina Fan 221463-AAV1 pAAV_BiPVe4_eGFP AAV construct expressing eGFP driven by chandelier cell-targeting...enhancer. Alias: pAAV_WDC0004_eGFP Gordon Fishell James M. Wilson 221463-PHPeB pAAV_BiPVe4_eGFP AAV construct...construct expressing eGFP driven by chandelier cell-targeting enhancer. Alias: pAAV_WDC0004_eGFP Gordon Fishell...
  13. AAV Molecular Tools

    Type
    Collection
    ...-length mouse HAPLN1 fused with cysteine-free GFP (cfGFP) under synapsin promoter. 8 Alexander Dityatev...lectican binding domain and fused with cysteine-free GFP (cfGFP) under synapsin promoter. 8 Alexander Dityatev...Cre-dependent Cre-dependent expression of membrane-bound GFP and synaptophysin-mRuby for labeling of axon terminals...5, 8 Nirao Shah , Jim Wells 124364 pAAV-FLEX-DTR-GFP CBA-driven, Cre-dependent Cre-dependent expression...expression of diphtheria toxin receptor fused to GFP for studying cell ablation. 2 Thomas Jessell , Eiman Azim... Serotype PI 98747 pAAV-FLEX-EGFPL10a EF1a-driven and Cre-dependent EGFP-tagged ribosomal L10a. 5, rg*...synaptophysin-EGFP for labeling of axon terminals. 1 Hongkui Zeng 71760 pAAV hSyn FLEx mGFP-2A-Synaptophysin-mRuby...
  14. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ...68299 GFP E17TAG/Q157TAG Plasmid 68298 GFP S2TAG/E17TAG Plasmid 68297 GFP Q157TAG Plasmid 68296 GFP S2TAG...Library 111704 Mode #1 Library Plasmid 69118 E17TAG GFP zeo resistance Plasmid 68307 SupD Strain 68306 C321...S2TAG Plasmid 68295 GFP E17TAG Plasmid 68294 SepOTSν Plasmid 68292 SepOTSλ Plasmid 68291 SepOTSκ Plasmid...
  15. Lentivirus Plasmids

    Type
    Collection
    ...Sabatini 171123 pLVX-TetOne-Puro-GFP 3rd Dox-inducible expression of GFP. Jason Sheltzer 20342 FUW-M2rtTA...hUbC-driven EGFP. Can be used for cDNA expression. David Baltimore 12247 pLVTHM 2nd EF-1a-driven GFP and shRNA...Brindle and Duncan Jodrell 17448 pLenti CMV GFP Puro (658-5) 3rd eGFP expression with CMV promoter and puromycin...expression of RFP as a reporter. See plasmid 17618 for GFP reporter. Linzhao Cheng 17452 pLenti CMV Puro DEST...more variants. Tyler Jacks 19319 pLJM1-EGFP 3rd CMV-driven EGFP fusion with puromycin resistance. Can ...Stephen Elledge 21373 pHIV-EGFP 3rd EF-1alpha driven expression of cDNA and and EGFP co-expression. See plasmid...119816 pLentipuro3/TO/V5-GW/EGFP-Firefly Luciferase 3rd Expression of EGFP-Firefly luciferase fusion protein...
  16. Viral Production

    Type
    Collection
    ... later, Cre-dependent GFP expression was detected with direct fluorescence. GFP was not detected in the...viral genomes (vg)/cell, pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] (Addgene 84445-AAVrg) alone at 1.1E6 vg/mL, ... prep # 55632-AAVrg). pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] was a gift from Edward Boyden (Addgene viral...
  17. Lentiviral Prep Service

    Type
    Collection
    ...Purpose PI 17446 pLenti CMV GFP Hygro (656-4) GFP Hygromycin 3rd gen lentiviral eGFP expression vector, CMV... 61422 dCAS9-VP64_GFP dCAS9 (D10A, H840A) none Expresses dCAS9-VP64 activator with 2A GFP Zhang 61425 ...analysis of clonal dynamics. This library expresses EGFP for easy visualization via direct fluorescence. ...
  18. Validated gRNA Sequences

    Type
    Collection
    ...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes...GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes 24825012 Sibley GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA...Christiaen EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria...24336571 Zhang EGFP A. victoria GAGCTGGACGGCGACGTAAA 51761 cut S. pyogenes 24336571 Zhang EGFP A. victoria...
  19. Serotype Testing AAV

    Type
    Collection
    ...AAV1). AAV Vectors for Serotype Testing pAAV-CAG-GFP (Plasmid #37825) Description : Ready-to-use AAV in...plasmid 37825 (deposited by Edward Boyden ) and direct GFP expression from the CAG promoter. For information... available from Addgene's viral service. Control EGFP vectors in various serotypes for serotype testing... 37825-AAVrg.T 20 µL $ 150 Add to Cart pAAV-hSyn-EGFP (Plasmid #50465) Description : Ready-to-use AAV ...plasmid 50465 (deposited by Bryan Roth ) and direct EGFP expression from the human synpasin promoter. For...
  20. Zhang Lab CRISPR Page

    Type
    Collection
    ...activator with 2A GFP 61423 : Expresses the MS2-P65-HSF1 activator helper complex with 2A GFP 61424 : sgRNA...(SapI)_hSyn-GFP-KASH-bGH (SpGuide acceptor). This is a AAV plasmid for sgRNA cloning. GFP-KASH fusion ...PX552; U6 promoter-driven; for sgRNA cloning; has GFP-KASH for FACS sorting SaCas9 + single guide RNA: ... recombinase-2A-EGFP-KASH 60231 : sgRNA cloning backbone with Cre recombinase-2A-EGFP-KASH Detailed backbone...recombinase-2A-EGFP-KASH and an sgRNA. #60231 - AAV:ITR-U6-sgRNA(backbone)-hSyn-Cre-2A-EGFP-KASH-WPRE-shortPA-ITR...efficiency. SpCas9 and SpCas9n with 2a-Puro and 2a-EGFP are also available. 2. SpCas9 (or SpCas9n, D10A ...SpCas9 and single guide RNA 48138 : PX458; SpCas9-2A-EGFP and single guide RNA 62988 : PX459; SpCas9-2A-Puro...
Showing: 1 - 20 of 54 results