We narrowed to 142 results for: MYC
-
TypeGuide... vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance...
-
Validated gRNA Sequences
TypeCollection...GTTCCGCGTTACATAACTTA 50927 S. pyogenes 24346702 Wolfe Neomycin TCATGGCTGATGCAATGCGG 67594 cut S. pyogenes 26178787...