We narrowed to 144 results for: MYC
-
TypeCollection...multicistronic expression of GFP and/or mCherry, with neomycin cassette Zebrafish, Sea urchin, Xenopus, and C...
-
Gamma-Retroviral Vector Guide
TypeGuide... vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance... -
Validated gRNA Sequences
TypeCollection...GTTCCGCGTTACATAACTTA 50927 S. pyogenes 24346702 Wolfe Neomycin TCATGGCTGATGCAATGCGG 67594 cut S. pyogenes 26178787... -
Lentiviral Vector Guide
TypeGuide... vectors have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance...