Skip to main content

We narrowed to 171 results for: plasmid for e coli

Showing: 141 - 160 of 171 results
  1. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...posts , or find CRISPR plasmids for your research. Addgene has CRISPR plasmids for the following models...Repeat) sequences were initially discovered in the E. coli genome in 1987, but their function as a safeguard...Mammalian systems (Human, mouse, and rat) Bacteria ( E. coli , Streptococcus , Streptomyces , and others) Drosophila... in the field, and enabling access to multiple plasmids used for various platform applications. For more...alkaline phosphatase isozyme conversion in Escherichia coli, and identification of the gene product. J Bacteriol...Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E. 2012. A programmable dual-RNA-guided DNA endonuclease... Saunders SJ, Barrangou R, Brouns SJ, Charpentier E, Haft DH, Horvath P, Moineau S, Mojica FJ, Terns RM...
  2. Antibodies 101: Introduction to Antibodies

    Type
    Blog Post
    ... be used for. Addgene’s Antibody Plasmid Collection includes plasmids that express antibodies, nanobodies...Engineering production of functional scFv antibody in E. coli by co-expressing the molecule chaperone Skp. Front...immunoglobulin genes, recombinant antibodies are plasmid-based. Their sequences can be optimized for specificity...protein (Wang et al., 2013). These proteins are also plasmid-derived. However, a disadvantage to ScFv is their...nanobodies, or synbodies, can be produced from plasmids, saving time and money. Nanobodies and synbodies...expression in cells that have been transfected with a plasmid encoding GFP. Actin, a common internal control ... as well as tools for developing and producing plasmid-based antibodies - and we’re always growing our...
  3. 15 Hot Plasmids from 2017

    Type
    Blog Post
    ...highlight a subset of the new plasmids in the repository through our hot plasmids articles. These brief articles...articles provide a synopsis of a plasmid or group of plasmids' functions and applications. We hope that... you to find and use the plasmids you need. You can find all the hot plasmids from 2017 below. With over...over 50,000 plasmids, we can't write posts for every great plasmid that comes into the repository, but...write about your plasmids in a future blog post. No time to read? Listen to our hot plasmids segment on the...editing for precise genome modification. Plasmid ID Plasmid Name Cas9 Variant Speacial Features 85169...Bacterial Expression Construct SpCas9 Inhibition (E. coli) Mammalian Expression Construct SpCas9 Inhibition...
  4. CRISPR Plasmids - Base Edit

    Type
    Collection
    ...for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...CRISPR Plasmids: Base Edit Browse CRISPR Plasmids By Function Genome Editing Cut Base Edit Nick Prime Edit... the tables below for CRISPR base editing plasmids. Plasmids are available for expression in mammalian...Mammalian ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Bacteria ID Plasmid Gene/Insert...Publication Plant ID Plasmid Gene/Insert Promoter Selectable Marker PI Publication Yeast ID Plasmid Gene/Insert...CRISPR plasmids for precisely editing DNA bases without inducing a DNA break. CRISPR...created by directed evolution of the Escherichia coli TadA, a tRNA adenine deaminase. Like cytosine base...
  5. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help... Plasmid Collections Empty Backbones Choosing Your Perfect Plasmid Backbone Empty backbones...Collection NLS Nuclear localization dCas9 plasmid - dCas9 expression plasmid without effector fusions; 3X Flag... of plasmids for packaging and expression, see our dedicated Adeno-associated Virus (AAV) Plasmids page...collection of plasmids for packaging and expression, see our dedicated Lentiviral Plasmids page Retroviral...contains AdEasy®-1 plasmid View our Adenovirus Plasmids page for more information Genome...of your cells will take up your plasmid. Thus, many plasmids have markers on them so that you...
  6. Promega Plasmid Collection

    Type
    Collection
    ...Promega Plasmid Collection Promega Plasmid Collection Ordering & Availability All Plasmids Plasmid Technology...our help center . Plasmid Collection Browse and sort the table below to find plasmids in the collection...a new window) on Promega.com. ID Plasmid Description Industry Plasmid Technology Overview This collection...Browse Addgene's Luciferase Plasmid Collection Explore other Promega plasmids available at Addgene Find ...for various protein expression systems including E. coli , mammalian cells, and cell-free systems. HiBiT...operational complexity. This unique collection contains plasmids developed by Promega scientists and designed to...HaloTag, SmBiT, and LgBiT. Ordering & Availability Plasmids from the Promega collection are available in two...
  7. COVID-19 Resources

    Type
    Collection
    ... Plasmid Collections COVID-19 – Plasmids and Resources COVID-19 and Coronavirus Plasmids & Resources...Antibodies SARS-CoV-2 Plasmids Other Coronavirus Plasmids Mammalian Targets General Plasmid Tools Pooled Libraries...Brian Geiss Plasmids SARS-CoV-2 Plasmids Browse the tables below to find popular plasmids expressing genes...to top Other Coronavirus Plasmids: SARS-CoV, MERS, BAT-CoV Plasmids ID Plasmid Description Industry PI ...Ginkgo Bioworks to distribute SARS-CoV-2 plasmids for E. coli , yeast, and mammalian expression, and spike...for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...for-profit entity, please see our Plasmid Distribution to Industry page. ID Plasmid Description Industry PI Additional...
  8. Viral Production

    Type
    Collection
    ...the transfer plasmid, a plasmid encoding Rep and serotype-specific Cap genes, and a plasmid encoding adenoviral...coli . In addition, plasmids are typically prepared using endotoxin-free plasmid purification kits. Resources...all plasmids used for viral production are propagated in the endA -mutated NEB Stable strain of E. coli...contamination is minimized by using an endotoxin-free plasmid purification protocol. To minimize the immunogenic...off-line and discarded. Confirmation of Transfer Plasmid Addgene uses a rigorous barcode matching system...experiment using our virus protocols . Browse our plasmid collection of popular lentiviral vectors ....
  9. Hot Plasmids September 2018 - Optogenetics, RNA Localization, Fluorescent Protein, and Base-editing Tools

    Type
    Blog Post
    ...highlight a subset of the new plasmids in the repository through our hot plasmids articles. These articles ...recent plasmid deposits and we hope they'll make it easier for you to find and use the plasmids you need...about a recent plasmid deposit please sign up here.   Listen this episode of Hot Plasmids! Light controls... with broccoli aptamers or MS2 tags using the same number of fluorophores. You can find plasmids containing...Hahn's lab at the University of North Carolina (plasmids at Addgene). It consists of two domains, LOV2 ...the Reuben Harris lab has deposited a reporter plasmid that allows for rapid fluorescence-based quantification...editing complexes are more efficient than the BE3 plasmid containing rat APOBEC1. Finally, they show that...
  10. CRISPR Guide

    Type
    Collection
    ...36593413 Vo, P. L. H., Ronda, C., Klompe, S. E., Chen, E. E., Acree, C., Wang, H. H., & Sternberg, S. H... R., Hanna, R. E., Hegde, M., Donovan, K. F., Strand, C., Sullender, M. E., Vaimberg, E. W., Goodale, ... the DNA and replaces it with another base. In E. coli , this strategy yields C to A base edits, whereas...harnessed for antiviral mechanisms in bacteria ( E. coli ). Like the other Cas enzymes, the Cascade-Cas3...edits. PASSIGE ( P rime- E diting- A ssisted S ite- S pecific I ntegrase G ene E diting), developed by the.... PMID: 26735016 Lee, J. K., Jeong, E., Lee, J., Jung, M., Shin, E., Kim, Y., Lee, K., Jung, I., Kim, ..., K. M., Aach, J., Guell, M., DiCarlo, J. E., Norville, J. E., & Church, G. M. (2013). RNA-Guided Human...
  11. CRISPR References and Information

    Type
    Collection
    ...Addgene CRISPR Resources CRISPR Plasmids Addgene's collection of CRISPR plasmids. CRISPR Guide Addgene's guide...and activation). Genome support for bacteria ( E. coli, B. subtilis ), yeast ( S. cerevisiae ), worm (...guide to using CRISPR plasmids in your lab, from knockouts to pooled library screening. CRISPR eBook Addgene's...barcoding. CRISPR Kits Addgene's collection of CRISPR plasmid kits. CRISPR Software Sanger Indel Analysis ICE... Feng Zhang Lab . Protocols Lab(s) Description Plasmids in protocol Download protocol Addgene CRISPR pooled...gRNA design and cloning for Cas9 orthologs Cas9 plasmids PDF, 107 KB Chen and Wente Zebrafish: gRNA cloning... (Cre recombinase) PDF, 105 KB Jaenisch CRISPR plasmid summary for transcriptional activation dCas9 activators...
  12. Cre-Lox and Other Site-Specific Recombinases

    Type
    Collection
    ...Site-Specific Recombinases Cre Plasmids Flp Plasmids Dre Plasmids Other Recombinase Plasmids Recombinase-Dependent...for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help... vectors. Highlighted Plasmids Browse the tables below to find popular plasmids expressing your favorite...tamoxifen”, or “light”): Cre Recombinase Plasmids ID Plasmid Description Vector Type Promoter PI Additional... with GFP Plasmids 101: FLEx Vectors Optimizing AAV DIO and FLEx Vector Expression Plasmids 101: Knockout... Flp Recombinase Plasmids ID Plasmid Description Vector Type Promoter PI Additional Addgene resources ...Neuroscientist’s View Return to top Dre Recombinase Plasmids ID Plasmid Description Vector Type Promoter PI Additional...
  13. Molecular Biology Reference

    Type
    Guide
    ...Molecular Genetics Plasmid Elements Working with Plasmids Introduction Types of Plasmids E. coli strains for ...prior to use in an experiment. E. coli strains for propagating plasmids E. coli are gram-negative, rod shaped...Restriction Cloning Plasmids 101: Inducible Promoters Plasmids 101: What is a plasmid? Plasmids 101: Antibiotic...Addgene blog posts relating to common E. coli lab strains and E. coli strains specialized for protein expression...propagating plasmids Antibiotics commonly used for plasmid selection DNA sequencing for plasmid verification...to be studied into the plasmid. Below are some common plasmid elements: Plasmid Element Description Origin...biology basics and plasmid components. Plasmids 101: Origin of Replication Plasmids 101: The Promoter ...
  14. Modular Cloning Guide

    Type
    Guide
    ...You may also like... Plasmid Kits Blog: Plasmids 101 Modular Cloning Blog: Plasmids 101 Modular Cloning...constrained only by the ability of E. coli to maintain the final plasmid after transformation. Figure 1: ...tuning in E. coli . CIDAR MoClo Extension, Volume I Bacterial Expression Richard Murray 110 plasmids designed...Trujillo Plasmids for reconstituting the ubiquitination cascades of different organisms in E. coli . MetClo...mammalian or E. coli expression. T2A Split/Link TurboID Kit Mammalian Expression Sven Eyckerman Plasmids to assemble...Applications and Kits Blog: Plasmids 101 Golden Gate Cloning Synthetic Biology Plasmids Modular Cloning (or MoClo...functional plasmids. It is a powerful and very efficient method for creating many plasmids from different...
  15. The Fluorescent Vegetables in Aptamer Soup

    Type
    Blog Post
    ...Browse fluorescent protein plasmids and resources See all Jaffrey lab plasmids ... cellular processes by transforming cells with plasmids encoding aptamer-tagged RNA and later introducing...aptamer downstream of a known promoter. Addgene’s Plasmids 101: Aptamer Fluorophores describes the enrichment...Nilaratanakul, Voraphoj, Debra A. Hauer, and Diane E. Griffin. "Development and characterization of sindbis... respectively. Both Red Broccoli and Orange Broccoli are derived from Broccoli, and share similar properties...properties to Broccoli despite binding to a different small molecule. Notably, like Broccoli, Red Broccoli and ...was described in the same study as Red Broccoli and Orange Broccoli, two more aptamers that bind DFHO and...
  16. A History of Genome Engineering in Popular Culture

    Type
    Blog Post
    ... our CRISPR guide Find CRISPR plasmids for your research Browse plasmids for base editing References ...10.1534/genetics.111.131433 Doudna JA, Charpentier E (2014) The new frontier of genome engineering with...CS, Ralston EJ, Lee AH, Amora R, Miller JC, Leung E, Meng X, Zhang L, Rebar EJ, Gregory PD, Urnov FD, ...serves as the code of life. In 1944, Oswald Avery, Colin MacLeod, and Maclyn McCarty’s experiment debunked...
  17. To Each HIS Own

    Type
    Blog Post
    ... tag plasmids here! Where should I place the tag and how many do I need? When designing a plasmid containing...from Addgene More Resources on the Addgene blog Plasmids 101: Protein Tags Antibodies 101: ChIP Antibodies...101: Introduction to Antibodies References Hochuli E, Bannwarth W, Döbeli H, Gentz R and Stüber D. Genetic...insulin-like growth factor I from culture medium of E.coli. Bio/Technology. 1987, 5:379-382. Bornhorst JA ...
  18. Validated gRNA Sequences

    Type
    Collection
    ...article 60224 cut S. pyogenes 25263330 Zhang LacZ E. coli TGCGAATACGCCCACGCGAT 60225 cut S. pyogenes 25263330...ACTCCAGTCTTTCTAGAAGA 64216 cut S. pyogenes 25803306 Kuhn rpsL E. coli AAAAAACCGAACTCCGCGCTGCGTAAAGTA 44505 cut S. pyogenes...CRISPR experiments. This datatable is compiled from plasmids in Addgene's database as well as from sequences..., the categories described on Addgene's CRISPR Plasmids and Resources page have been used to indicate ...Datatable Target Gene Target Species Target Sequence Plasmid ID Application Cas9 Species PubMed ID Depositor...AAGTTCGTATGGAAGGTTCCGTTAA 74075 interfere S. pyogenes 26829286 Lu LacZ E.coli CCCGAATCTCTATCGTGCGG 74179 cut S. pyogenes 26627737...
  19. Tetracycline Inducible Expression

    Type
    Collection
    ...Mammalian shRNA Plasmids Collection Cre-lox Plasmids Collection Stem Cell Research Plasmids Collection Tetracycline...for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help.... ID Plasmid Description Transactivator Promoter PI 21915 Tet-pLKO-puro Lentiviral Tet-On plasmid for ...with puromycin selection. See Plasmid #85973 for blasticidin and Plasmid #85972 for hygromycin selection...search our collection for all dox-regulated plasmids . ID Plasmid Description PI 63800 PB-TRE-dCas9-VPR Tet-inducible...have adapted an antibiotic resistance operon from E. coli : the tetracycline repressor protein (TetR) and...expression and find plasmids for your experiments using tet- or dox-inducible systems. Plasmid...
  20. Luciferase Plasmid Collection

    Type
    Collection
    ...for other plasmids that should be added to this list? Fill out our Suggest a Plasmid form or e-mail help...Luciferase Plasmids Luciferase Plasmid Collection Empty Backbones Expression Constructs Reporter Constructs...otherwise noted, these plasmids are meant for expression in mammalian systems. ID Plasmid Luciferase Type(s...preparations of select luciferase expression plasmids. ID Plasmid Luciferase Type Promoter Description PI ...luciferase gene allow for increased copy number in E. coli and expression of luciferase in the cytoplasm of...of luciferase plasmids for gene expression assays and bioluminescent reporters. Plasmid... Plasmid Collections Luciferase...
Showing: 141 - 160 of 171 results