Addgene

We narrowed to 167 results for: tox

Showing: 141 - 160 of 167 results

Results per page:

The Fluorescent Vegetables in Aptamer Soup

Type

Blog Post

...imidazolinone (DFHBI). DFHBI is membrane permeable and non toxic to cells. Because it rapidly photobleaches, DFHBI...
Transferable Skills Guide: Conflict Resolution

Type

Blog Post

...for the sake of disagreeing. It can be extremely toxic in a lab or work environment if left unchecked. ...
AAV Purification by Iodixanol Gradient Ultracentrifugation

Type

Protocol

...macromolecules. Importantly, iodixanol is inert and non-toxic to mammalian cells. Therefore, and unlike other ...
Virus Protocol - Generating Stable Cell Lines

Type

Protocol

...reduced growth rates, especially if that transgene is toxic. Eventually, the rapidly growing low-level transgene...
Is this the right place for me? 8 tactics for choosing a lab

Type

Blog Post

... choose wisely. From the Tenure She Wrote blog, Toxic Academic Mentors. What is workplace bullying? ...
Affinity Purification of Recombinant Antibodies with Protein A or Protein G

Type

Protocol

...reproducibility in science. Safety Warnings Sodium azide is toxic. When handling, use proper personal protective equipment...
Validated gRNA Sequences

Type

Collection

...ACTTTAAAAGTATTCGCCAT 48656 cut T. denticola 24076762 Church UPRT Toxoplasma gondii GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes...
Important Considerations When Using AAVs

Type

Blog Post

...tracing methods used viruses that were potentially toxic and would result in cell death. With several new...
Quick Guide to All Things Lentivirus

Type

Blog Post

...constitutively or inducibly. If your gene of interest is toxic or needs to be expressed a certain point in the ...
RNA Interference in Plant Biology: New Tools for an Old Favorite

Type

Blog Post

...organisms with functional APT will convert 2-FA to cytotoxic nucleotides, resulting in death. In the presence...
Mycoplasma Contamination: Where Does It Come From and How to Prevent It

Type

Blog Post

...removal from the infected culture. MRAs are non-toxic, effective in the removal of most of the mycoplasma...
An “elegans” Approach to Better CRISPR/Cas9 Editing Efficiency

Type

Blog Post

...repair templates. They found that Cas9 RNPs could be toxic at high concentrations, and editing efficiency improved...
Lambda Red: A Homologous Recombination-based Technique for Genetic Engineering

Type

Blog Post

... of Red proteins is critical for minimizing the toxic effects of Gam expression and to limit spontaneous...
Sequencing Options for CRISPR Genotyping

Type

Blog Post

...multiplexing Requires delivery of dsODN (potentially toxic) Digenome Seq 0.1% Cell-free (in vitro) Works ...
Custom CRISPR Screens & the Green Listed Software

Type

Blog Post

...phenotype (e.g. survival of a cancer cell as a cytotoxic drug is added), and decide which genes you’d like...
Special Delivery: Fluorophore Targeting for FRET Studies

Type

Blog Post

...was originally developed to treat heavy metal intoxication in chemical warfare [Vilensky & Redman, 2003...
AAV Production in HEK293 Cells

Type

Protocol

...post transfection. Changing the media can reduce toxicity associated with PEI and allow for the addition...
Antibody Validation for Flow Cytometry

Type

Blog Post

...target with very low expression, due to induced toxicity caused by the protein of interest. HLDA workshop...
CRISPR Methods for Bacteria: Genome Engineering, CRISPRa, CRISPRi, Base Editing, and More

Type

Blog Post

...system has generally low efficiencies or can be proteotoxic when used in Mycobacterial species, Sarah Fortune...
Troubleshooting and Optimizing a Western Blot

Type

Blog Post

...Western Blotting. Journal of Pharmacological and Toxicological Methods, 64, 233–237. https://doi.org/10.1016...

Showing: 141 - 160 of 167 results

Results per page:

The Fluorescent Vegetables in Aptamer Soup

Transferable Skills Guide: Conflict Resolution

AAV Purification by Iodixanol Gradient Ultracentrifugation

Virus Protocol - Generating Stable Cell Lines

Is this the right place for me? 8 tactics for choosing a lab

Affinity Purification of Recombinant Antibodies with Protein A or Protein G

Validated gRNA Sequences

Important Considerations When Using AAVs

Quick Guide to All Things Lentivirus

RNA Interference in Plant Biology: New Tools for an Old Favorite

Mycoplasma Contamination: Where Does It Come From and How to Prevent It

An “elegans” Approach to Better CRISPR/Cas9 Editing Efficiency

Lambda Red: A Homologous Recombination-based Technique for Genetic Engineering

Sequencing Options for CRISPR Genotyping

Custom CRISPR Screens & the Green Listed Software

Special Delivery: Fluorophore Targeting for FRET Studies

AAV Production in HEK293 Cells

Antibody Validation for Flow Cytometry

CRISPR Methods for Bacteria: Genome Engineering, CRISPRa, CRISPRi, Base Editing, and More

Troubleshooting and Optimizing a Western Blot

Help Center

Deposit Plasmids

General Reagents

Viral Service

DNA Service

Plasmid Collections