We narrowed to 172 results for: tox

1. Antibodies 101: Introduction to Gating in Flow Cytometry

   Type

   Blog Post

   ...-mouse CD8b-PerCP-Cy5.5), which is present on cytotoxic T killer cells but not dendritic cells. Using ...

2. CRISPR 101: Homology Directed Repair

   Type

   Blog Post

   ... can be used, however, these are generally more toxic to cells than their plasmid counterparts. Another...

3. Transferable Skills Guide: Conflict Resolution

   Type

   Blog Post

   ...for the sake of disagreeing. It can be extremely toxic in a lab or work environment if left unchecked. ...

4. Four Ways to Package Transgenes That Exceed the Size Limit of Adeno-associated Virus

   Type

   Blog Post

   ...non-functional, they could be dominant-negative and/or toxic. A potential solution is to include an in-frame ...

5. Virus Protocol - Generating Stable Cell Lines

   Type

   Protocol

   ...reduced growth rates, especially if that transgene is toxic. Eventually, the rapidly growing low-level transgene...

6. Affinity Purification of Recombinant Antibodies with Protein A or Protein G

   Type

   Protocol

   ...reproducibility in science. Safety Warnings Sodium azide is toxic. When handling, use proper personal protective equipment...

7. Plan Your Experiment

   Type

   Collection

   ... lowest immunogenicity and are one of the least toxic methods for in vivo viral delivery. Additionally...

8. Fluorescent Protein Guide: Subcellular Localization

   Type

   Collection

   ...B4GALT1(1-61) mTurquoise2 Dorus Gadella 68073 GalToxBFP Golgi apparatus GalT signal anchor transmembrane...

9. Is this the right place for me? 8 tactics for choosing a lab

   Type

   Blog Post

   ... choose wisely. From the Tenure She Wrote blog, Toxic Academic Mentors.  What is workplace bullying? ...

10. Sequencing Options for CRISPR Genotyping

    Type

    Blog Post

    ...multiplexing Requires delivery of dsODN (potentially toxic) Digenome Seq 0.1% Cell-free (in vitro) Works ...

11. Important Considerations When Using AAVs

    Type

    Blog Post

    ...tracing methods used viruses that were potentially toxic and would result in cell death. With several new...

12. Quick Guide to All Things Lentivirus

    Type

    Blog Post

    ...constitutively or inducibly. If your gene of interest is toxic or needs to be expressed a certain point in the ...

13. Lambda Red: A Homologous Recombination-based Technique for Genetic Engineering

    Type

    Blog Post

    ... of Red proteins is critical for minimizing the toxic effects of Gam expression and to limit spontaneous...

14. An “elegans” Approach to Better CRISPR/Cas9 Editing Efficiency

    Type

    Blog Post

    ...repair templates. They found that Cas9 RNPs could be toxic at high concentrations, and editing efficiency improved...

15. RNA Interference in Plant Biology: New Tools for an Old Favorite

    Type

    Blog Post

    ...organisms with functional APT will convert 2-FA to cytotoxic nucleotides, resulting in death. In the presence...

16. Mycoplasma Contamination: Where Does It Come From and How to Prevent It

    Type

    Blog Post

    ...removal from the infected culture. MRAs are non-toxic, effective in the removal of most of the mycoplasma...

17. AAV Production in HEK293 Cells

    Type

    Protocol

    ...post transfection. Changing the media can reduce toxicity associated with PEI and allow for the addition...

18. Special Delivery: Fluorophore Targeting for FRET Studies

    Type

    Blog Post

    ...was originally developed to treat heavy metal intoxication in chemical warfare [Vilensky & Redman, 2003...

19. Custom CRISPR Screens & the Green Listed Software

    Type

    Blog Post

    ...phenotype (e.g. survival of a cancer cell as a cytotoxic drug is added), and decide which genes you’d like...

20. Validated gRNA Sequences

    Type

    Collection

    ...ACTTTAAAAGTATTCGCCAT 48656 cut T. denticola 24076762 Church UPRT Toxoplasma gondii GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes...