...gram-negative bacterial endotoxin is ensured to be less than 5 endotoxin units per mL. The endotoxin assay is carried... absence of unexpected DNA contaminants. Endotoxin Endotoxin contamination in vector preparations can ...large animal studies. Endotoxin contamination is minimized by using an endotoxin-free plasmid purification...addition, plasmids are typically prepared using endotoxin-free plasmid purification kits. Resources Browse...

...RIFLE, TAL LTA lymphotoxin alpha (TNF superfamily, member 1) LT, TNFB, TNFSF1 LTB lymphotoxin beta (TNF superfamily...member 1 CD94 LGMN legumain AEP, LGMN1, PRSC1 LTA lymphotoxin alpha (TNF superfamily, member 1) LT, TNFB, TNFSF1...SHP-1, SHP-1L, SHP1 RAC1 ras-related C3 botulinum toxin substrate 1 (rho family, small GTP binding protein..., TC-25, p21-Rac1 RAC2 ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein...EN-7, Gx, HSPC022 RAC3 ras-related C3 botulinum toxin substrate 3 (rho family, small GTP binding protein... RNase A family, 2 (liver, eosinophil-derived neurotoxin) EDN, RNS2 ROBO1 roundabout, axon guidance receptor...12A (natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1, p35) CLMF, IL-...

...Parasites such as Plasmodium (malaria), Toxoplasma (toxoplasmosis), Trypanosoma (African sleeping sickness...PI Publication Libraries Toxoplasma CRISPR Knockout Pooled Library - Toxoplasma gondii CRISPR genome-wide...

...Information Background New England Biolabs offers non-toxic protein labeling systems based on SNAP-, CLIP-, ...membrane, nucleus, etc.) are also available Non-toxic to living cells To learn more about this system,...

... handled at BSL-1, AAVs expressing oncogenes or toxins should be handled at BSL-2. AAV can transduce both...non-dividing cells with a low immune response and low toxicity. Although recombinant AAV does not integrate into...

...particle) and toxicity of the gene product (i.e., if the gene encoded by the transfer plasmid is toxic to mammalian...

...low levels to reduce toxicity; See PI page for other recombinases that are less toxic in Drosophila hsp70...recombination is a very useful tool, Cre expression can be toxic in some systems, notably Drosophila. Read Addgene's...

...tagRFP Ebert pSAG1::CAS9-U6::sgUPRT 54467 Other/Toxoplasma gondii none, Q5 mutagenesis yes, cut S. pyogenes...pyogenes Sibley pU6-Universal 52694 Other/Toxoplasma gondii BsaI yes, cut S. pyogenes Lourido pRGE31 50929...

...2 plasmid) Knockout Human Moffat 3rd 4 70,948 Toxoplasma Knockout 80636 Knockout T. gondii Lourido N/A...

...Photo-activatable iRFPs can be ‘turned on’ by non-phototoxic far-red light and are used for spatially selective...

...Cre-dependent Cre-dependent expression of diphtheria toxin receptor fused to GFP for studying cell ablation...

...Entamoeba histolytica Leishmania sp. Plasmodium sp. Toxoplasma gondii Trypanosoma sp. Plasmids for Viruses Species...

...homolog RAC RAC1 RAC2 RAC3 Ras-related C3 botulinum toxin substrate (rho family, small GTP binding protein...

...-driven, Cre-dependent expression of diphtheria toxin receptor (DTR)–GFP fusion protein. Azim et al. Nature...

...systems. Dox also has good tissue distribution, low toxicity, a known half-life (24 hours), and is compararably...

...resistance to chemotherapy drugs, resistance to toxins, cell viability, and tumor metastasis. Currently...dividing and non-dividing cells AAV is the least toxic method for in vivo viral delivery RNA delivery of...

...which may aid disulfide bond formation or prevent toxicity. Compatible with Gateway cloning. pGTvL1-SGC 39188...

...B4GALT1(1-61) mTurquoise2 Dorus Gadella 68073 GalToxBFP Golgi apparatus GalT signal anchor transmembrane...

...ACTTTAAAAGTATTCGCCAT 48656 cut T. denticola 24076762 Church UPRT Toxoplasma gondii GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes...

... reveals a role for pH regulation in hair cell toxicity and function. Dis Model Mech. 2014 Jul;7(7):847...