...picniced outside of our new office space on the nicely manicured lawn of University Park at MIT.  I’m ...

...including those for preparing your own competent cells. If you’re familiar with the process of creating...

...describes the specifics of these regions in eukaryotic cells. Core Promoter The core promoter region is located...bind. Histones are proteins found in eukaryotic cells that package DNA into nucleosomes. Histone binding...element controls the rate of transcription. Bacterial cells contain sigma factors which assist the RNA polymerase...ribosomal RNA (rRNA) which is a main component of a cell’s ribosome structure. Ribosomes are the site of protein...

...we are today. As part of our 20th anniversary celebration, we thought it only fitting to share some stories...

...that helps our users focus on the fun stuff, accelerating research and discovery. We work with transparency...

...the mesocorticolimbic system in addiction. Front Cell Neurosci. 2014;8:466. PubMed PMID: 25653591. PubMed...

...Murine stem cell virus, forward primer MSCV-rev CAGCGGGGCTGCTAAAGCGCATGC Murine stem cell virus, reverse...CCCTTGAACCTCCTCGTTCGACC (BD Biosciences) Murine stem cell virus, forward primer pBABE 5' CTTTATCCAGCCCTCAC...pLXSN 5' CCCTTGAACCTCCTCGTTCGACC (MSCV) Murine stem cell virus, same as MSCV, forward primer pMRB101-F AAGATGCAGGCAGCTGAGTT...

...Most housekeeping proteins are highly expressed in cells. This means that at sample concentrations appropriate...

...Shravanti Suresh is a PhD candidate who investigates cellular aspects of CRISPR/Cas immune systems in the Sashital...

... can treat the underrepresented individuals too nicely. When the work of the underrepresented individual...