Skip to main content
Addgene

We narrowed to 849 results for: HA

Showing: 321 - 360 of 849 results
  1. Advice on Career Paths and the Green Card Process for International Researchers and Entrepreneurs

    Type
    Blog Post
    ...continue their careers in the United States. There has been a growing shift away from employers sponsoring...that the researcher is working under in the lab or has won, awards, media reports, and membership in groups...that you are a classically trained ballerina who has performed at Lincoln Center. Your case should only...only support tenure track professors. Casseus Law has seen that research institutions are willing to sponsor... your current research goal is and why your work has impacted your field (i.e. finding vaccines for deadly...The platinum standard for an expert is someone who has cited your work. Immediate steps that you can take...
  2. Plasmids 101: Dimers and Multimers

    Type
    Blog Post
    ...trimers, tetramers). Since then, multimerization has been observed to occur in many different kinds of...sequences. In some specific cases, multimerization has been observed to occur more frequently in plasmids... Ausubel, 1976). In fact, if your plasmid sample has a mix of different-sized multimers, you may even ...~3.6 kb and ~1.1 kb (lane 3). Uncut DNA (lane 2) has a band at <3 kb, which corresponds to the supercoiled...multimers is capillary gel electrophoresis (CGE), which has been used in plasmid vaccine and gene therapy development...
  3. Lambda Red: A Homologous Recombination-based Technique for Genetic Engineering

    Type
    Blog Post
    ...changes, and the addition of protein tags. It also has the flexibility to modify the E. coli chromosome,...recombineering system The lambda red recombineering system has three components (Figure 1): 1) Exo, 2) Beta, and... in the center of the sequence. Since lambda red has a higher recombination frequency when the lagging...activating MMR: 1) use a strain of bacteria that has key MMR proteins knocked out or 2) specially design...recombinant clones If a antibiotic resistance gene has been inserted, recombinants can first be selected...
  4. Sequencing Primers

    Type
    Guide
    ...forward primer HA-F TACCCATACGACGTCCCAGA HA tag, forward primer HA-R TCTGGGACGTCGTATGGGTA HA tag, reverse...primer you need? Email us at [email protected] Addgene has used a number of primers for sanger sequence verification...
  5. Hot Plasmids: Fall 2024

    Type
    Blog Post
    ...epitope (GKPIPNPLLGLDST) has been used as a tag since 1992 (Hanke et al., 1992), and has proven itself a versatile...like PROTAC targeted protein degraders. But CRBN has been difficult to study in vitro, requiring either...Cas9 system By Aryana Khosravani Deborah Hung’s lab has developed a novel dual-plasmid CRISPR/Cas9 system...
  6. Hot Plasmids Spring 2024

    Type
    Blog Post
    ...optical pooled CRISPR screening, Paul Blainey’s lab has developed a multiplexing approach to Cas9-based pooled... stabilize the 3’ end of the pegRNA. As research has just begun with PE7, it will be exciting to see future...conferred several new improvements. The new variant has increased signal-to-noise ratio and better ability...limitations of traditional AAVs, the Becirovic Lab has developed REVeRT, for gene delivery using reconstitution...
  7. Antibodies 101: Reading a Flow Plot

    Type
    Blog Post
    ...right corner.      Figure 2: This flow plot has two populations that are B+ and one population that...Figure 3 above, until the population of interest has been successfully identified and isolated.  Following...from Boix et al., 2018, uses quadrants to gate and has numbers representing the percentage of cells in each...2017). Neonatal immune response to rhinovirus A16 has diminished dendritic cell function and increased ...
  8. Transferable Skills Guide: Creativity

    Type
    Blog Post
    ...as a scientist has been building your creativity all along. In my own career, my team has used these techniques...and instead building an environment where everyone has their ideas heard.  So how can we assure that all...continue advocating for your idea. Our product team has implemented a policy of never rejecting an idea simply...
  9. The PAM Requirement and Expanding CRISPR Beyond SpCas9

    Type
    Blog Post
    ...within the human genome. Another variant, xCas9 3.7 has 7 mutations found in the REC2, REC3, and PAM interacting...CRISPR toolbox The isolation of novel CRISPR proteins has and will continue to dramatically increase the number...additional targeting flexibility. Cas13a (formerly C2c2) has been adapted for targeted RNA cleavage in mammalian... MH, Tang W, Chen L, Sun N, Zeina CM, Gao X, Rees HA, Lin Z, Liu DR (2018) Evolved Cas9 variants with ...
  10. Binning Singletons: Tackling Conference Networking When You Don’t Know Anyone

    Type
    Blog Post
    ...never went away. While he has frequent bouts with Impostor Syndrome, Joe has found his people through ... match people within similar fields (ASM Microbe has eight tracks), something we didn’t have enough people...notebook paper, despite the fact that it was gray. He has worked in molecular and microbiology for the last...
  11. Rett Syndrome: A History of Research and Therapeutic Outlooks

    Type
    Blog Post
    ...The Rett Syndrome Research Trust (RSRT) has an ambitious goal of curing Rett Syndrome and Addgene is ....  As a non-degenerative, monogenic disease that has shown reversibility of symptoms in animal models,...neuronal subtypes of the hippocampus. This technology has formed the basis of the Rett syndrome program being....1138389 Le TTH, Tran NT, Dao TML, Nguyen DD, Do HD, Ha TL, Kühn R, Nguyen TL, Rajewsky K, Chu VT (2019) ...
  12. Addgene Stands with the Scientific Community

    Type
    Blog Post
    ... undermine critical research infrastructure that has taken decades to establish.These funding decisions...Together Throughout history, the scientific community has demonstrated remarkable resilience and creativity...
  13. Grad School Advice Part 2: Building Community

    Type
    Blog Post
    ...time in grad school. As you'll learn, grad school has its ups and downs for everyone but you can come out...their grad student communities 5:59 - 8:16 : What has made you unhappy in grad school? As part of this ...
  14. Fueled by Coffee at #SfN14

    Type
    Blog Post
    ...repository, and getting feedback from our community. It has been great to hear all the words of support from ...from scientists using Addgene in their labs. And it has been exciting to learn about all the amazing research...
  15. Keeping Up With CRISPR/Cas9

    Type
    Blog Post
    ...of just how big and mainstream the news on CRISPR has gotten, consider these headlines in The New York ...New York Times feature when he said, “All of this has basically happened in a year. It’s incredible.” ...
  16. Viral Vectors 101: Viral Vector Elements

    Type
    Blog Post
    ...Adenovirus is a linear, dsDNA virus naturally. It has ITRs, just like AAV, which encompass the expression...packaging and entry Adenovirus is quite large and has more helper plasmid components than the other viruses...of adenovirus Building viral vectors Addgene has many viral vectors and helper plasmids for all the...
  17. 15 Years of Addgene: The Top 15 Plasmids

    Type
    Blog Post
    ...15 years of plasmid sharing has certainly taken us on many adventures...From moving office locations ...plasmids are from the Zhang lab. In fact, the Zhang lab has shared over 40,000 CRISPR-Cas9 components over the...Chimeric_BB-CBh-hSpCas9 - The S. pyogenes Cas9 (SpCas9) has been widely popular in genome engineering. For use...
  18. FlipGFP, a novel fluorescence protease reporter to study apoptosis

    Type
    Blog Post
    ...in vivo scientists need a protease reporter that has a large dynamic range and high brightness. The Shu...in the midgut of Drosophila, an observation that has been difficult until now (Zhang et al., 2019). Conclusion...Conclusion FlipGFP is a novel fluorogenic reporter that has a large dynamic range and high brightness. This reporter...
  19. Plasmids 101: Cre-lox

    Type
    Blog Post
    ...restricted based on experimental constraints. This has been used for a wide range of purposes, including...Cre-containing adenovirus (Ad-Cre) or AAV (AAV-pgk-Cre) has been used to successfully introduce Cre into cells... can be an effective alternative to Cre-lox, and has also been used in conjunction with it, allowing for...
  20. CRISPR Methods for Bacteria: Genome Engineering, CRISPRa, CRISPRi, Base Editing, and More

    Type
    Blog Post
    ...in bacteria, most CRISPR-based genome engineering has taken place in other organisms. In many bacteria,... targets cells in which homologous recombination has not occurred. This powerful negative selection system... works similar to the original pCas/pTargetF but has many other advantages including shorter plasmid curing...plasmids Noting that the more common spCas9 system has generally low efficiencies or can be proteotoxic ...system can be delivered a number of ways but success has been observed with Phagemids (Selle et al., 2020,...microbiome Beyond the human gut, the Barrick lab has deposited plasmids that can be used to engineer the...
  21. A Conference By Postdocs For Postdocs: Future of Research

    Type
    Blog Post
    ...Henry Bourne, Professor Emeritus at UCSF. Dr. Bourne has some radical (and some not so radical) suggestions...called The Balsa Group. University of Pennsylvania has the Penn Biotech Group and PBG Healthcare Consulting...
  22. Why Do I Need an MTA Anyway?

    Type
    Blog Post
    ...and you need the right experimental materials. Who has time for paperwork? Here’s why a Material Transfer...confidence. Benefits of the UBMTA: Peace of mind Addgene has adopted the terms of the Uniform Biological Material...
  23. Viral Vectors 101: Systemic Capsids

    Type
    Blog Post
    ...effective than both AAV9 and AAV5, which has tropism for lung cells, and has increased overall transduction throughout...this definition: A systemic capsid is a capsid that has been engineered to have enhanced function after intravenous...both). Therefore, a high-efficiency systemic capsid has better efficacy than AAV9 and/or its intermediate...used in LY6A-nonpermissive mouse strains. **AAV1-X1 has not been tested in rats. For more information on ...neurons in the CNS (Chan et al., 2017). AAV-PHP.eB has frequently been used for screening candidate regulatory...depositing manuscript) across the brain. AAV-BI-28 has been tested in C57BL/6J mice and effectively transduces.... 4c, Jang et al., 2023; Brown et al., 2021.) It has a similar transduction rate to AAV-PHP.eB in the ...
  24. Which Fluorescence Microscopy Techniques is Best for Me?

    Type
    Blog Post
    ... to its unrivaled contrast, fluorescence imaging has emerged as the dominant light microscopy contrast...blue to excite a molecule of GFP. Because red light has approximately half the energy of blue light, two ... be establish for this to happen.Using red light has a second advantage: red light penetrates deeper into...imaging depths closer to 1 mm. Traditionally, 2-photon has been a very slow imaging technique but recent advances... modern explosion in light microscopy techniques has provided biologists with a host of tools and opened...
  25. Fluorescent Proteins 101: Monitoring Cell Mobility Using Fluorescent Proteins

    Type
    Blog Post
    ... cell mobility within these complex environments has never been easy and, for many years, researchers ...Intravital imaging powered by two-photon microscopy has uncovered host-pathogen interactions leading to the...proteins can be used in your experiments, experience has shown that some are more reliable and more efficient...important to finely tune the excitation wavelength as it has been shown that even a small incremental change of...this system called Brainbow, the Ubow mouse strain has been created to fate map Langerhans cells and follicular...
  26. Pipetting Protocol

    Type
    Protocol
    ... flow rate into the pipette tip. Once the liquid has finished drawing into the pipette tip, lift the pipette...
  27. Summer SciComm Series: Cognitive Load

    Type
    Blog Post
    ... a lot quicker to pick up new languages!) Jargon has a place in science communication, but the more you...length of your average PhD to achieve!) Each field has its own framework: a particular way of organizing... amount of knowledge and expertise your audience has is a major factor in how quickly they can understand...
  28. Antibodies 101: ELISA (Enzyme-linked Immunosorbent Assay)

    Type
    Blog Post
    ...antibody is biotin-conjugated, streptavidin (which has a high affinity for binding biotin), is conjugated...detecting one protein from the sample. A direct ELISA has many fewer steps than a sandwich or competitive ELISA...linear portion or the OD of your experimental samples has reached 4.0, you can resolve this issue when you ...
  29. How to Prepare for an Industry Interview

    Type
    Blog Post
    ...all four parts of a STAR answer once the interview has started. Instead, I preferred to prepare stories ...stories for an interview, since one story usually has more than one theme and can be used to answer multiple...new idea to the company’s area of expertise. This has potential to make your audience really sit up and...
  30. CRISPRainbow and Genome Visualization

    Type
    Blog Post
    ...called the 4D nucleome. Visualizing specific loci has historically been difficult, as techniques like fluorescent...visualize genomic loci in vivo The flexibility of CRISPR has improved our ability to target almost every genomic... system and induce genome editing. Such a system has been previously described for transcriptional activation...
  31. Pairing CombiGEM and CRISPR for Combinatorial Genetic Screening

    Type
    Blog Post
    ...CombiGEM-CRISPR: The marriage of two simple platforms CRISPR has revolutionized how we decode the genome by making...guide RNAs (gRNAs) for genome editing in large-scale has led to the rapid generation of genome-wide gRNA libraries...the users’ specific research questions. CombiGEM has been successfully applied to functionally characterize...
  32. Using AAV for Neuronal Tracing

    Type
    Blog Post
    ...auditory neuronal circuitry in vivo. A variant of RABV has been developed to only label a neuronal connection...example only dopaminergic neurons, neuronal tracing has the added benefit of only labelling the subset of... regions used. Evidence for retrograde transport has been found for AAV1, -2, -5, -7, -8 (Taymans et al...AAV5 (Aschauer et al., 2013). Anterograde transport has been observed for AAV1, -5, -8 (McFarland et al.,...variability compared to chemical tracers. rAAV2-retro also has lower affinity for heparin, which possibly explains...vectors cover some of these attributes and their use has allowed for the visualization of single connection...intracerebral application, which is more invasive and has a much higher risk of complications. References...
  33. An Integrin Antibody Toolkit from IPI

    Type
    Blog Post
    ...IgG2a  Rat   Targeting integrins in the lab The Ha and Springer labs recently showed RGD-binding integrins... interpret the roles of individual integrins. The Ha lab — in collaboration with the Springer lab, the...Leucine-Valine-Aspartate-Proline (LVDP) motif. The Ha and Springer teams employed IPI synthetic antigen-binding... J., Yan, J., Waterman, C. M., Springer, T. A., & Ha, T. (2022). Single-molecule characterization of subtype-specific...
  34. Building Global Connections with the International Mentorship Program USA-EUROPE

    Type
    Blog Post
    ...in the same field that I do: prostate cancer. She has guided me in my next steps. For example, how to get...to travel abroad, how to write cover letters, and has suggested important things to emphasize in order ...insecurities… all shrink when shared with a mentor who has experienced them before and who can serve as a role...universities and future generations of professionals has made possible a significant qualitative and quantitative...
  35. Top Requested AAV of 2017: pmSyn1-EBFP-CRE

    Type
    Blog Post
    ...lentiviral service is going strong, the AAV service has shown incredible growth this year. pAAV-hSyn-DIO-...pmSyn1-EBFP-Cre from Hongkui Zeng’s lab. This AAV has had over 150 orders since coming online! pmSyn1-EBFP-Cre...
Showing: 321 - 360 of 849 results