... contains an IRES-GFP construct that enables co-expression of GFP with the transgene of interest. With...the early genes necessary for replication have been deleted from the shuttle vector. Early gene E1 is provided...vectors that contain IRES-GFP pShuttle Class of transfer vectors that do not contain GFP Additional Vocabulary...genome are i nverted t erminal r epeats (ITRs). Genes are divided into early (E1-4) and late (L1-5) transcripts... to enter cells. Recombinant adenovirus has two genes deleted: E1 and E3. E1 is supplied by the adenovirus...33Kb adenoviral plasmid containing the adenoviral genes necessary for virus production. The shuttle vector...throughout virus production. During experiments, GFP can be used to sort cells infected with adenovirus...

...excised by Cre recombinase. Addgene has several great options: pLV hUbC-dCas9-T2A-GFP for removable dCas9 expression...investigation into the regulation of your favorite gene. But have no fear - I’m here to introduce you to...genome – could be affected, leading to unpredicted gene expression changes (Sapozhnikov and Szyf 2021, Charlton...interact with transcriptional machinery to modify local gene expression, confounding any potential conclusions...causal relationship between DNA demethylation and gene expression (Sapozhnikov and Szyf 2021).    ... expressing blasticidin or puromycin resistance genes.  It’s that simple! Good luck and happy editing...Vogelstein B (1983) Hypomethylation distinguishes genes of some human cancers from their normal counterparts...

... later, Cre-dependent GFP expression was detected with direct fluorescence. GFP was not detected in the...genomes (vg)/cell, pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] (Addgene 84445-AAVrg) alone at 1.1E6 vg/mL, or both...Karl Deisseroth (Addgene viral prep # 55632-AAVrg). pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] was a gift from... plasmid encoding Rep and serotype-specific Cap genes, and a plasmid encoding adenoviral helper sequences...viral vectors are tested in vitro and in vivo for gene expression and/or function. These data are sometimes...copies of the lentiviral Rev responsive element (RRE) gene and the cellular ribonuclease P/MRP 30 kDa subunit...Production AAV distributed by Addgene has been produced either in-house by Addgene scientists or through collaboration...

... enriched relative to controls using Split-BioID-GFP and BioID run on six unrelated proteins. One caveat...study binary protein interactions. However, FRET generally only tells you if two proteins interact and cannot...with your research? Plasmids are available from Addgene! References Schopp, I.M., Ramirez, C.C., Debeljak...Central PMCID: 5053326. Additional Resources on the Addgene Blog Learn about techniques for visualizing protein...-DNA Interactions with CUT&RUN Resources at Addgene.org Find plasmids from the Bethune Lab Find Plasmids...

...-invasive systemic gene delivery in non-human primate (NHP) brains.  Systemic gene delivery capsids previously...Monomeric StayGold variants AAV.CAP-Mac for systemic gene transfer in primate brains Endothelial-specific ..., Myc and SV40 Nuclear Localization Signals, and GFP. B) Workflow to assess Cas9-PAGE editing with viral...Adeno-associated viral vectors for functional intravenous gene transfer throughout the non-human primate brain....plasmid here! Chen, X., et al. (2023). Functional gene delivery to and across brain vasculature of systemic...past decade, primary cells remain difficult to genetically edit due to toxicity from electroporation or ... under CC-BY license.   The Miyawaki lab generated a series of StayGold mutants and identified a ...

...contain a toxin gene (regulated by a rhamnose-inducible promoter) and a chromoprotein gene. Allelic exchange...contrast, the widely used green fluorescent protein (GFP) gives a bright green fluorescence when exposed to...the plate. For example, if your plasmid contains a gene encoding a blue chromoprotein, after transforming...3: pTOX plasmids expressing amilCP and tsPurple genes. Image: Lazarus et al., 2019. One such lab is...protein family. What sets them apart is the way they generate their color: they strongly absorb visible light...difficult to directly use in bacteria, where most genetic manipulations start. Anthony Forster’s lab used...eforRed, asPink, spisPink, scOrange, fwYellow, amilGFP, amajLime, cjBlue, meffBlue, aeBlue, amilCP, tsPurple...

...under-expressing clones. If GFP-encoding cDNA is co-transfected at a favorable ratio to the gene of interest (or,...overexpress genes of interest; more recently we have also been using Addgene CRISPR vectors to generate cell ...cell lines with knockouts of specific genes. Many years ago, people in the laboratory became frustrated with...with different levels of expression of our gene of interest. Advantages of the agarose cloning method ...figure 1.   Find Additional Useful Protocols on Addgene's Protocol Pages Agarose cloning method procedure...-well cell plate to a 96-well assay plate. We generally freeze at least 2 ampules each of 4 clones with...som.umaryland.edu.   Additional Resources on the Addgene Blog Tips for a 1st Time CRISPR User (by a 1st...

...domain, forward primer GFP-F GGTCCTTCTTGAGTTTGTAAC 3' end of GFP, forward primer GFP-R CCATCTAATTCAACAAGAATTGGGACAAC...In lacZ gene M13 (-40) GTTTTCCCAGTCACGAC In lacZ gene M13 Reverse CAGGAAACAGCTATGAC In lacZ gene M13/pUC...Invitrogen) In lacZ gene M13/pUC Reverse AGCGGATAACAATTTCACACAGG (Invitrogen) In lacZ gene MBP-F GATGAAGCCCTGAAAGACGCGCAG...resistance gene, forward primer Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance gene, reverse ...terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP), forward primer hUBCpro-F...reverse primer M13 Reverse CAGGAAACAGCTATGAC In lacZ gene MSCV CCCTTGAACCTCCTCGTTCGACC (BD Biosciences) Murine...ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene, reverse primer AUG1 Forward CAATTTACATCTTTATTTATTAACG...

...Purpose PI 17446 pLenti CMV GFP Hygro (656-4) GFP Hygromycin 3rd gen lentiviral eGFP expression vector, CMV... 61422 dCAS9-VP64_GFP dCAS9 (D10A, H840A) none Expresses dCAS9-VP64 activator with 2A GFP Zhang 61425 ...Screening Use pooled CRISPR libraries to screen for genes involved in specific biological processes. For more... Plasmid Pooled Libraries . ID Name Description Genes/Insert Selection PI Human knockout pooled libraries...library in backbone lentiGuide-Puro targeting 19,114 genes and containing 76,441 unique sgRNAs along with 1000...SpCas9. 76,441 unique sgRNAs targeting 19,114 human genes along with 1000 non-targeting controls Puromycin...library in backbone lentiCRISPRv2 targeting 19,114 genes and containing 76,441 unique sgRNAs along with 1000...

...Vectors Read about Reporter Gene like Luciferase and GFP Resources on Addgene.org Find Plasmids for Your...depending on its orientation to your gene. T7lac High levels of gene expression Promoter from T7 bacteriophage...modulating gene expression through varied inducer concentrations. trp High levels of gene expression...human or mouse) General expression mRNA Mammalian promoter from phosphoglycerate kinase gene.  Constitutive...deacetylation. Ubc General expression mRNA Mammalian promoter from the human ubiquitin C gene Constitutive  ... human beta actin General expression mRNA Mammalian promoter from beta actin gene Constitutive  Ubiquitous... Requires the presence of Gal4 gene to activate promoter. Ac5 General expression mRNA Strong insect ...

...sequence (UAS) of its target gene, in this case a reporter gene (e.g. luciferase or GFP), regardless of whether...promoter of the reporter gene to activate expression (Figure 2c). The reporter gene then allows detection...reporter gene (3, 4), there are now many variations, including many that use auxotrophic rescue genes as reporters...Shapira S.K., Chou J. Beta-galactosidase gene fusions for analyzing gene expression in Escherichia coli and ...hybrid system (also called the interaction trap), genes encoding proteins of interest(POI’s) are fused to... in a yeast strain that also contains a reporter gene cloned downstream of a promoter containing the target... the “bait”, Figure 2b) cannot activate reporter gene expression on its own, but, if the two POI’s interact...

...the ccdB gene is replaced by the gene of interest. As a result, cells that retain the ccdB gene die off...tool. The plasmid pKSCTMF contains the mazF gene and a gene for Zeocin resistance (Figure 2). This MazF-ZeoR...The team used this cassette to knock out genes, knock in a GFP cassette, and introduced site-directed mutations...antisense RNA regulates hok gene expression indirectly through the overlapping mok gene." Journal of molecular...associated genes. These systems better ensure that plasmids are passed down through generations (Figure ...application of CcdB is GatewayTM cloning, where the ccdB gene serves as a counterselectable marker in the destination...toxin-antitoxin system to construct a stable synthetic gene circuit that can be used over prolonged periods....

...Express a gene of interest fused to the C-terminus of SCFP3A Amber N1 Yellow Mammalian Express a gene of interest...Express a gene of interest fused to the C-terminus of Amber mVenus N1 Yellow Mammalian Express a gene of interest...Clover (a GFP variant) commonly used with mRuby2 pLSSmOrange-N1 Orange Mammalian Express a gene of interest...your choice of fluorescent fusion protein with your gene of interest: Plasmid Color Expression Description...Aquamarine mCerulean N1 Cyan Mammalian Express a gene of interest fused to the N-terminus of monomeric...Cerulean mCerulean C1 Cyan Mammalian Express a gene of interest fused to the C-terminus of monomeric...monomeric Venus mVenus C1 Yellow Mammalian Express a gene of interest fused to the C-terminus of monomeric...

...Resources on the Addgene Blog Learn More About Fluorescent Protein Aggregation Catch Up On Your GFP Basics Get...expression time. 2. Timer functionality with a single gene Although it is possible to make a timer system composed...cargoes to FP timer mk-GO (Tsuboi et al.) Monitor gene expression in the developing pancreas by placing...FP timer DsRed-E5 under the control of Neurog3 (a gene controlling pancreatic differentiation) in mouse...(trafficking to a subcellular location, start of gene expression, development of a cell structure, etc...formation of limbs are correlated with changes in gene expression. In a developing embryo, for example,...long-lived transcription factors control gross changes in gene expression as new body sections are formed. In synthetic...

..., or a mutation can be introduced in a gene, while adding a GFP-tag (Figure 3). Achieving multiple modifications...insertions, deletions, and point mutagenesis to complex assembly of multiple genes. Primer design for each type...amplified, restriction digested or even a synthesized gene. PCR is the primary method to produce the linear...included in a single PCR, for example for subcloning genes from different templates. All PCRs are run as an... 5’ end of either primer. Subcloning - To move a gene from one vector to another simply amplify the vector... to the 5’ end of the reverse primer. Mutagenesis - Mutagenesis is performed by designing primers astride...using the same three step protocol:  Fragment generation - Any linear DNA fragments can be assembled in...

... a superfolder GFP fusion to stabilize the protein in mammalian cells. LwaCas13a-msfGFP can mediate cleavage... (Shmakov et al., 2015). They were using Cas1, a gene commonly associated with CRISPR arrays and involved...analysis, they identified 53 potential candidate genes that fell into 3 categories based on the architecture...expressing 5 gRNAs simultaneously produces comparable gene knockdown to single gRNA expression. Although the...plasmids from this paper at Addgene. Additional Resources on the Addgene Blog Check Out Our CRISPR Featured...27, 2020. CRISPR, and specifically Cas9 from S. pyogenes (SpCas9), is truly an exceptional genome engineering... PMC5127784. Find plasmids from this paper at Addgene. 2. East-Seletsky, Alexandra, et al. "Two distinct...

...swapping and generating N and C terminally tagged fusion proteins with fluorescent (YFP, GFP, CFP, RFP, ...transcriptional and translational dynamics of genes and proteins in living plants, to complementing mutant phenotypes...potato contains Agrobacterium T-DNAs with expressed genes: An example of a naturally transgenic food crop....simplifying plant genetic engineering Using arabidopsis in the classroom Resources on Addgene.org Find plant... transformation. There are many motivations to generate transgenic Arabidopsis, from studying transcriptional... floral drip or dip transformation method. The general steps for this method include: Cloning and transforming...Glazebrook, 2002). Find plant plasmid resources at Addgene  Choosing an expression system Choosing an appropriate...

...negative bacteria periplasm. Efforts to tag endogenous genes for proteins in these compartments using CRISPR ...tagging to detect proteins expressed from cloned genes: deletion mapping functional domains of Drosophila...Lindsey M. Costantini, and Erik L. Snapp. "Superfolder GFP is fluorescent in oxidizing environments when targeted...quantitative imaging experiments and cell physiology in general. Pitfalls of Fluorescent Protein Fusions Observing...cellular compartments other than the cytoplasm. Generally, FPs evolved in or were engineered for use in ...N-glycosylation consensus sequences in popular FPs. This generated a palette of inert green, cyan, yellow, and blue...standard FPs. The moxFPs are now available through Addgene Many thanks to our guest bloggers Erik L. Snapp...

...check out our article: Fluorescent Proteins 101: GFP Fusion Proteins - Making the Right Connection. Cellular...been generated for yeast (Kim et al., 2019) and fruit flies (Bischof et al., 2018), the generation of such...quantities (and the correct stoichiometric ratios) to generate useable data. What’s more, measuring and quantifying...straightforward nature of BiFC also makes it easier to generate a large number of constructs for high-throughput...screening of PPIs. For example, Bischof et al. (2018) generated an open reading frame (ORF) library to screen ... such resources in less genetically tractable organisms lags behind. BiFC can also be used to screen for...pair. Find BiFC plasmids for your experiment at Addgene! How to Design a BiFC Experiment Much like FRET...

...which must be stabilized by monomeric superfolded GFP and averages only ~50% RNA knockdown. In initial ...plasmids from this paper at Addgene. Additional Resources on the Addgene Blog Check out our CRISPR Featured...and designated this system REPAIRv1. Using next-generation sequencing, they confirmed A->I editing and found...cytosine deaminase. Three rounds of rational mutagenesis on the ADAR2DD residues that contact the RNA ...RNA-sequencing, the authors performed rational mutagenesis and identified that a S375A mutation in RESCUE...PMID: 29070703. Find plasmids from this paper at Addgene. Abudayyeh, Omar O., et al. “RNA targeting with...PMID: 28976959. Find plasmids from this paper at Addgene. Abudayyeh, Omar O., et al. "C2c2 is a single-...