We narrowed to 266 results for: his-tag
-
TypeCollection...collections: Tags and Other Markers : Antibodies targeting popular markers like tubulin or epitope tags like ...species. We currently assess western blot, immunohistochemistry, and immunocytochemistry. Addgene will continue...
-
Generating Mouse Models Using CRISPR/Cas9
TypeBlog Post...of CRISPR in 2013 (Cong et al., 2013)! Haoyi got his first exposure to CRISPR when he used this new technology... embryos as Cas9 from S. pyogenes and has the advantage of being smaller (Zhang et al., 2016). For editing...replacement of the murine sequence with a human gene. Advantages of using CRISPR for mouse genome engineering ...the efficiency discussed above extends 4 major advantages of CRISPR mouse editing when compared to more...Post for Tips on CRISPR Gene Editing in Mice Disadvantages of using CRISPR for generating mouse models ... -
Harnessing Bacterial Toxins for Allelic Exchange
TypeBlog Post...blogger Jacob Lazarus from Harvard. Jake received his MD and a PhD in Cell and Molecular Biology from the...switched over to pTOX. However, we feel it has clear advantages, and are hopeful that continued development of... -
Antibodies 101: Flow Cytometry
TypeBlog Post...Fluorescent Protein Should I Use? However, fusion proteins tag your protein of interest with a fluorescent reporter...protein. One downside of fusion proteins is that the tag can alter the structure of the protein. In some cases...timing of expression can also be affected by the tag. Protein expression, measured using antibody conjugated..., determining cell health, analyzing cell cycle stages, and detecting specific populations of cells in...system converts the fluorescence intensity to a voltage pulse, called an event, and assigns each event ... then gate the B cell population and create a histogram of CD19-containing cells versus total cell number... -
Quick Guide to All Things Lentivirus
TypeBlog Post... still infect the researcher and insert into her/his genome - this is a biosafety risk Infects dividing...to infect your cells of interest. Advantages Disadvantages Can carry large transgenes (>8 kb) Potential... cells, it was obvious that its safety was a disadvantage particularly for clinical development. In addition...Efficient gene transfer Potential for insertional mutagenesis: Replication-incompetent lentiviruses with human... -
Validated gRNA Sequences
TypeCollection...GCCACAAATCAGATTAATTTGG 64940 tag S. pyogenes 26355004 Mendenhall CREB1 H. sapiens GCCACAAATCAGATTAATTTGGG 64939 tag S. pyogenes...GAAAAGGATAATTGAGCCCCAGG 64254 tag S. pyogenes 26355004 Mendenhall GABPA H. sapiens TTTGGAGTCTCAGAATGTCCTGG 64255 tag S. pyogenes... 24967838 Mashimo ATF1 H. sapiens TAGGAATCAAACACTTTTATTGG 64690 tag S. pyogenes 26355004 Mendenhall ATM...pyogenes 25307933 Vale CEBPB H. sapiens CTCCGGCCACTGCTAGCGCGG 64036 tag S. pyogenes 26355004 Mendenhall CEBPB...CEBPB H. sapiens GCCGGCAGGGGGACGCGCGCGG 64047 tag S. pyogenes 26355004 Mendenhall Cent1 M. musculus GGCAACGTTTGACTTCCTGA...Xue RAD21 H. sapiens CCAAGGTTCCATATTATATAAGG 64057 tag S. pyogenes 26355004 Mendenhall rde-1(D718) C. elegans...rerio GTGCGCAACACATAGCACCA 65566 cut S. pyogenes 25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914... -
CRISPR Guide
TypeCollection...DNA. The system can use common tags, like 3xFLAG-tag, PA, and biotin tags, or an anti-Cas9 antibody. The...in mammalian cells include: SunTag system - co-expression of epitope-tagged dCas9 and antibody-activator...acid, turn a promoter on/off, or add small protein tags. Precise Modifications Using Homology Directed Repair...genetic modification ). Browse Plasmids: Endogenous Tagging CRISPR Base Editing To overcome low HDR efficiency...also be fused to the gRNA to recruit fluorescently-tagged RNA-binding proteins (RBPs). Multicolor CRISPR ...dCas9s (e.g. S. pyogenes dCas9 and S. aureus dCas9) tagged with different fluorescent proteins or by fusing...sequence specified by a particular gRNA. Epitope tag(s) are fused to dCas9 or gRNA for efficient purification... -
Transferable Skills Guide: Teamwork
TypeBlog Post...likely to lead to scores. That player doesn’t trust his teammates; the teammates don’t trust him. This team...Meselson-Stahl, Hershey-Chase...Who was I to dispute history? And boy did I make the right decision. If I’d ...the first place? Let’s think about some of the advantages of team-based work: Nobody knows everything anymore...Jefferson dined alone.” There was a time in human history when an intelligent, motivated person really could... -
Antibodies 101: Designing Your First Flow Panel
TypeBlog Post... lab of Arlene Sharpe at Harvard Medical School. His projects include investigating negative regulators...itself, like laser type and power, acquisition voltage, the concentration of the fluorophore, and whether...bd-spectrum-viewer. But what is the real-life advantage of a brighter fluorophore? Strong brightness makes... -
New and Upcoming Viral Vectors - Spring 2019
TypeBlog Post... vectors for experiments encoding a fluorescent-tagged molecular tool. Find pAAV-FLEX-tdTomato, pAAV-GFAP104...variant in AAV1 at Addgene! Archon1, a voltage sensor AAV Historically, electrical activity in the brain was...measured with implanted electrodes. The Archon1 voltage reporter allows a way to monitor neuronal electrical...Archon1-KGC-GFP-ER2]) of this membrane-embedding voltage detector. Find Archon1 and its cre-dependent version...pAAV-hSyn-EGFP *Also coming in our new 20 ul trial size! Voltage indicators Plasmid Serotype Name 119036 AAV1... -
CRISPR Plasmids and Resources
TypeCollection...genome-wide screening. Purify dCas9 fused to an epitope tag can be used to isolate a given genomic locus. Visualize...discover links to CRISPR forums, and more. CRISPR History : Learn how CRISPR was modified from a bacterial... -
GCE4All: Making Genetic Code Expansion Accessible
TypeBlog Post...proteins in E. coli (Zhu et al., 2022). It uses the TAG codon for the phosphoserine and, because it uses ...technology or as a therapeutic. A (very) brief history GCE came onto the synthetic biology scene in 1989...essentially those needed to make site-directed mutagenesis, many researchers new to GCE aren’t able to successfully... V. W. (2021). Genetic Code Expansion: A Brief History and Perspective. Biochemistry, 60(46), 3455–3469... -
Improved Plasmid Maps Powered by SnapGene
TypeBlog Post...markers, promoters, origins, tags, and certain ORFs. Their sophisticated detection algorithm easily and... -
Hot Plasmids - October 2020
TypeBlog Post...wrmScarlet11 which is less than 60 nt in length to tag the target protein. The team validated this tool ...2020.07.02.185249 Predicting cell cycle length with a histone-fused fluorescent timer By Kate Harten DeMaio Studies...color-changing fluorescent timer (FT) protein to the histone H2B that allows for observation in live cells.... human and plant cells. Its small size offers advantages for cellular delivery. Get the plasmids at Addgene... -
Brain Initiative Collection
TypeCollection...Fluorescent reporter for serotonin (dendrite localization tag) Lin Tian 135420-AAV1 pAAV-syn-FLEX-jYCaMP1s Yellow...AAV vector for Cre-dependent expression of Venus-tagged parapinopsin driven by the CAG promoter. Used for...AAV vector for Cre-dependent expression of Venus-tagged parapinopsin driven by the Ef1a promoter. Used ...with pAAV-TREtight-mTagBFP2-B19G Ian Wickersham 100799-AAV1 pAAV-TREtight-mTagBFP2-B19G helper virus for...production plasmid encoding for Archon1 fluorescent voltage reporter, Cre-dependent expression Edward Boyden...pGP-AAV-syn-FLEX-Volton2-ST-WPRE AAV-mediated expression of voltage sensor under the Syn promoter, Cre-dependent expression... -
MXS Chaining
TypeBlog Post...localization 1 TagBFP 399nm/ 456nm histone 2B (H2B) Chromatin 2 Cerulean 433nm/ 475nm Lyn-tag (derived from...newly generated MCS. MXS-chaining also has the advantage of being directional, meaning that (in the previous... 3. Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, Smith HO.Enzymatic assembly of DNA molecules... -
Antibodies 101: Conjugation
TypeBlog Post...inclusion of non-canonical amino acids or peptide tags. 5) Strong protein-protein interactions with other...typically used in microscopy-based assays like immunohistochemistry, though they are also a common choice for...through several different mechanisms. Most take advantage of chemical groups intrinsically present on antibodies... -
Plasmids 101: Biotinylation
TypeBlog Post...Efficient biotinylation and single-step purification of tagged transcription factors in mammalian cells and transgenic...biotinylation. This 13 amino acid sequence is termed AviTag. Using AviTag, one can label a protein of interest with...situ hybridization histochemistry: use for mRNA detection.” The Journal of Histochemistry and Cytochemistry...interaction has also been adapted for use in immunohistochemistry and antibody labelling. In these experiments...referred to as the Avidin-Biotin Complex (ABC) immunohistochemistry (IHC). For more information on ABC and IHC...Scientific's Biotinylation Reagent Selection Tool. AviTag and BirA Proteins can also be biotinylated by exploiting...with biotin by simply creating a fusion in which AviTag is added to either the N or C terminus of the protein... -
What's Your Organism? Expanding Genomic Tools via the NSF EDGE Program
TypeBlog Post...Addgene is certainly going to have to find ways to tag and curate reagents from these emerging organisms...college I studied development and evolution of histone genes in Strongylocentrotus purpuratus, the spiny...neurobiology, and more. Prochlorococcus (Penny Chisholm) This cyanobacterium is the smallest photosynthetic... -
Plasmids 101: Common Lab E. coli Strains
TypeBlog Post...perfect empty backbone, made sure to add the right tags to your gene, and may have even put a fluorescent... your plasmid or carrying out your experiment. History of E. coli strains E. coli are gram-negative, rod... DH5alpha and DH10b (also known as TOP10). The history of B strain is a bit more convoluted due to researchers...researchers sharing and renaming samples throughout history. It was likely isolated in 1918 but was first referred...