Skip to main content

We narrowed to 266 results for: his-tag

Showing: 161 - 180 of 266 results
  1. Antibodies 101: Introduction to Gating in Flow Cytometry

    Type
    Blog Post
    ... lab of Arlene Sharpe at Harvard Medical School. His projects include investigating negative regulators..., largely depends on cell type and laser voltage. The voltage describes an electric potential that can... the cell or on its surface. Bear in mind, the voltage setting of the laser impacts the magnitude of FSC...setting as needed. To figure out the appropriate voltages to observe your cells on a flow plot, you might...respectively. H, A, and W describe the shape of a histogram, which graphically represents the time and intensity...graph of photocurrent vs. time. The resulting histograms is described through maximum current (H), the...the signal strength. So, we need to adjust the voltage in the cytometer’s software in order to generate...
  2. How to Make Friends and Meet People at a Scientific Conference

    Type
    Blog Post
    ...hello. Keep your cards handy and make sure your name tag is always visible. Some people learn names by seeing... them. It is OK to ask someone to see their name tag if you are one of those people. Meet people in sessions...or make one!) or find the conference's Twitter hashtag. Use social media to let others know you will attend...Conference Dinner - by Julio Peironcely on the Thesis Whisperer "Not Networking - Building Relationships for Success...
  3. Plasmids 101: Gibson Assembly and Other Long-Homology Based Cloning Methods

    Type
    Blog Post
    ...into a vector with a large tag at the N-terminus, but you don’t have the tag already included in the vector...you can insert both the gene of interest and the tag sequences into the vector in one step without scars...In this blog post, I will go over some advantages, disadvantages, and examples of how scientists are using... common, and for good reason. They offer many advantages over the traditional restriction enzyme cloning...thereof) nor a serious time commitment. Another advantage is that this process makes it easy to generate...will be using. Some of these products may offer advantages that Gibson assembly does not such as increased... 1. Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA 3rd, Smith HO. Enzymatic assembly of DNA molecules...
  4. Sequencing Primers

    Type
    Guide
    ...TACCCATACGACGTCCCAGA HA tag Forward HA-R TCTGGGACGTCGTATGGGTA HA tag Reverse HAT GAGGAGCACGCTCATGCCCAC Histidine affinity...affinity tag Forward hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator Reverse hU6-F GGGAAACGCCTGGTATCTTT...promoter Forward Myc GCATCAATGCAGAAGCTGATCTCA Myc tag Forward Neo-F CGTTGGCTACCCGTGATATT 3' end of neomycin...' of MCS in pTrcHis vector Forward pTrcHis Reverse GATTTAATCTGTATCAGG 3' of MCS in pTrcHis vector, same...BGH-R TAGAAGGCACAGTCGAGG Bovine growth hormone terminator Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human...promoter Forward T7 TAATACGACTCACTATAGGG T7 promoter Forward T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator ...Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1 promoter Reverse BGH-R TAGAAGGCACAGTCGAGG Bovine...
  5. Fluorescent Proteins 101: Photoactivatable Fluorescent Proteins

    Type
    Blog Post
    ...FPs) offer scientists a simple yet powerful way to tag cellular proteins and investigate protein localization...fusion, etc). For example, by engineering PA-GFP tagged to a mitochondrial matrix protein (mito-PAGFP) ...Markus, and Wei‐Lih Lee. "Photoactivatable GFP tagging cassettes for protein‐tracking studies in the budding...an FP-chimeric protein may be at any one of many stages of synthesis and degradation. For this reason it...reversible photoactivation - and have enabled sophisticated imaging techniques.     Irreversible photoactivation...victoria) GFP (wtGFP) by mutating Threonine 203 to Histidine (T203H) (1). wtGFP normally contains a mixed population...PA-FPs by performing several rounds of random mutagenesis screening for enhanced RFP variants. PA-mCherry...
  6. Generating Mouse Models Using CRISPR/Cas9

    Type
    Blog Post
    ...of CRISPR in 2013 (Cong et al., 2013)! Haoyi got his first exposure to CRISPR when he used this new technology... embryos as Cas9 from S. pyogenes and has the advantage of being smaller (Zhang et al., 2016). For editing...replacement of the murine sequence with a human gene. Advantages of using CRISPR for mouse genome engineering ...the efficiency discussed above extends 4 major advantages of CRISPR mouse editing when compared to more...Post for Tips on CRISPR Gene Editing in Mice Disadvantages of using CRISPR for generating mouse models ...
  7. Harnessing Bacterial Toxins for Allelic Exchange

    Type
    Blog Post
    ...blogger Jacob Lazarus from Harvard. Jake received his MD and a PhD in Cell and Molecular Biology from the...switched over to pTOX. However, we feel it has clear advantages, and are hopeful that continued development of...
  8. Antibodies 101: Flow Cytometry

    Type
    Blog Post
    ...Fluorescent Protein Should I Use? However, fusion proteins tag your protein of interest with a fluorescent reporter...protein. One downside of fusion proteins is that the tag can alter the structure of the protein. In some cases...timing of expression can also be affected by the tag.  Protein expression, measured using antibody conjugated..., determining cell health, analyzing cell cycle stages, and detecting specific populations of cells in...system converts the fluorescence intensity to a voltage pulse, called an event, and assigns each event ... then gate the B cell population and create a histogram of CD19-containing cells versus total cell number...
  9. Quick Guide to All Things Lentivirus

    Type
    Blog Post
    ... still infect the researcher and insert into her/his genome - this is a biosafety risk Infects dividing...to infect your cells of interest.   Advantages Disadvantages Can carry large transgenes (>8 kb) Potential... cells, it was obvious that its safety was a disadvantage particularly for clinical development. In addition...Efficient gene transfer Potential for insertional mutagenesis: Replication-incompetent lentiviruses with human...
  10. Optogenetics AAV Preps

    Type
    Collection
    ...PHPeB Clear Filters ID Name Promoter Opsin Variant Tag Activity Serotype PI 20071 pACAGW-ChR2-Venus-AAV ...ChrimsonR (soma-targeted) GCaMP8s Cre dependent 9 Mark Histed 183519 pAAV-CaMKIIa-ChRmine-oScarlet-KV 2.1-WPRE...
  11. CRISPR Guide

    Type
    Guide
    ...DNA. The system can use common tags, like 3xFLAG-tag, PA, and biotin tags, or an anti-Cas9 antibody. The...in mammalian cells include: SunTag system — co-expression of epitope-tagged dCas9 and antibody-activator...acid, turn a promoter on/off, or add small protein tags. Precise Modifications Using Homology Directed Repair...Plasmids: Double-Strand Break (Cut) , Endogenous Tagging CRISPR Base Editing To overcome low HDR efficiency...also be fused to the gRNA to recruit fluorescently-tagged RNA-binding proteins (RBPs). Multicolor CRISPR ...dCas9s (e.g. S. pyogenes dCas9 and S. aureus dCas9) tagged with different fluorescent proteins or by fusing...sequence specified by a particular gRNA. Epitope tag(s) are fused to dCas9 or gRNA for efficient purification...
  12. Transferable Skills Guide: Teamwork

    Type
    Blog Post
    ...likely to lead to scores. That player doesn’t trust his teammates; the teammates don’t trust him. This team...Meselson-Stahl, Hershey-Chase...Who was I to dispute history? And boy did I make the right decision. If I’d ...the first place? Let’s think about some of the advantages of team-based work: Nobody knows everything anymore...Jefferson dined alone.” There was a time in human history when an intelligent, motivated person really could...
  13. Antibodies 101: Designing Your First Flow Panel

    Type
    Blog Post
    ... lab of Arlene Sharpe at Harvard Medical School. His projects include investigating negative regulators...itself, like laser type and power, acquisition voltage, the concentration of the fluorophore, and whether...bd-spectrum-viewer.   But what is the real-life advantage of a brighter fluorophore? Strong brightness makes...
  14. Tetracycline Inducible Expression

    Type
    Collection
    ...expression gene of interest fused with 3xFLAG and 2xStrep-tag from TRE3G promoter for Tandem-Affinity Purification...operator ( tet O, a 19 nucleotide sequence, TCCCTATCAGTGATAGAGA). In normal conditions, the TetR protein ... Karpf 167935 pLenti-tetON-KRAB-dCas9-DHFR-EF1a-TagRFP-2A-tet3G Tet-inducible expression of KRAB-dCas9...monosynaptic tracing. To be coinjected with pAAV-TREtight-mTagBFP2-B19G ( Plasmid #100799 ). Ian Wickersham 172878...state of each cell in a population. Proliferation history is monitored by the dilution of a dox-inducible...
  15. New and Upcoming Viral Vectors - Spring 2019

    Type
    Blog Post
    ... vectors for experiments encoding a fluorescent-tagged molecular tool.   Find pAAV-FLEX-tdTomato, pAAV-GFAP104...variant in AAV1 at Addgene! Archon1, a voltage sensor AAV Historically, electrical activity in the brain was...measured with implanted electrodes. The Archon1 voltage reporter allows a way to monitor neuronal electrical...Archon1-KGC-GFP-ER2]) of this membrane-embedding voltage detector. Find Archon1 and its cre-dependent version...pAAV-hSyn-EGFP *Also coming in our new 20 ul trial size! Voltage indicators Plasmid Serotype Name 119036  AAV1...
  16. GCE4All: Making Genetic Code Expansion Accessible

    Type
    Blog Post
    ...proteins in E. coli (Zhu et al., 2022). It uses the TAG codon for the phosphoserine and, because it uses ...technology or as a therapeutic.  A (very) brief history GCE came onto the synthetic biology scene in 1989...essentially those needed to make site-directed mutagenesis, many researchers new to GCE aren’t able to successfully... V. W. (2021). Genetic Code Expansion: A Brief History and Perspective. Biochemistry, 60(46), 3455–3469...
  17. Hot Plasmids - October 2020

    Type
    Blog Post
    ...wrmScarlet11 which is less than 60 nt in length to tag the target protein. The team validated this tool ...2020.07.02.185249 Predicting cell cycle length with a histone-fused fluorescent timer By Kate Harten DeMaio Studies...color-changing fluorescent timer (FT) protein to the histone H2B that allows for  observation in live cells.... human and plant cells. Its small size offers advantages for cellular delivery. Get the plasmids at Addgene...
  18. MXS Chaining

    Type
    Blog Post
    ...localization 1 TagBFP 399nm/ 456nm histone 2B (H2B) Chromatin 2 Cerulean 433nm/ 475nm Lyn-tag (derived from...newly generated MCS. MXS-chaining also has the advantage of being directional, meaning that (in the previous... 3. Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, Smith HO.Enzymatic assembly of DNA molecules...
Showing: 161 - 180 of 266 results