Skip to main content

We narrowed to 240 results for: kit

Showing: 161 - 180 of 240 results
  1. Luciferase Plasmid Collection

    Type
    Collection
    ...control of neuronal signaling. TRUPATH Kit , ONE-GO Biosensors Kit , and G-CASE : BRET-based sensors for...
  2. CRISPR 101: Epigenetics and Editing the Epigenome

    Type
    Blog Post
    ...several epigenetic modifiers, and is available as a kit from Addgene.   Find Ready-to-Use Viral Preps for...2017). Genome and epigenome engineering CRISPR toolkit for probing in vivo cis-regulatory interactions...
  3. Validated gRNA Sequences

    Type
    Collection
    ...26480473 Wolfe Kit-1 R. norvegicus CATCTGTGCGGCCGTTGGCT 60969 cut S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus...CTAACGTTCCAGCGCTCGTT 60970 cut S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus GTCAAGATGTCATCTTACGG 60971 cut S....
  4. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Fluorescent Protein Fusion Construct Kit Neveu Lab MXS Chaining Kit Luciferase Plasmid Collection Promega...Expression Return to top Additional Resources Plasmid Kits and Collections Empty Backbone Collection Michael...
  5. p53 Pathway

    Type
    Collection
    ...p53 Pathway You May Also Like: Cancer Pathway ORF Kit mTOR pathway Ras pathway Background p53 Pathway Plasmids...
  6. An “elegans” Approach to Better CRISPR/Cas9 Editing Efficiency

    Type
    Blog Post
    ...SapTrap CRISPR/Cas Toolkit and SapTrap-SEC kit for C. elegans genome engineering have also facilitated CRISPR... C. elegans genome. Toolkits for editing in C. elegans The development of toolkits such as the SapTrap...CRISPR editing in C. elegans. These modular toolkits build single plasmid targeting vectors that encode ...
  7. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ... the cpFRET kit from the Pertz laboratory to construct custom biosensors. The ScEnSor Kit from the Olsson...neuropeptides VIP, NPY, CCK, NTS, UCN, SST, and CRF A tool kit of highly selective and sensitive genetically encoded...intracellular environment of S. cerevisiae . The MOSAIC Kit from the Cohen laboratory includes 35 plasmids expressing... Angew Chem Int Ed Engl. 2018 Jun 27. Tetsuya Kitaguchi ATP Variants of ATP sensor iATPSnFR1.0 and iATPSnFR1.1.... PLoS One. 2014 Jun 24;9(6):e100252. Tetsuya Kitaguchi cAMP (cyclic AMP) Red fluorescent protein-based...imaging. Sci Rep. 2017 Aug 4;7(1):7351. Tetsuya Kitaguchi cAMP (cyclic AMP) Fluorescent sensor of cyclic...PDE5alpha. ACS Sens. 2017 Jan 27;2(1):46-51. Tetsuya Kitaguchi cGMP (cyclic GMP) FlincG3 (GFP-based cGMP sensor...
  8. Fluorescent Proteins: FRET

    Type
    Collection
    ...biosensors with the cpFRET kit from the Pertz Lab or the 2in1 Plasmid Toolkit from the Grefen Lab. FRET...
  9. Western Blot

    Type
    Protocol
    ...the protein concentration using a Pierce BCA Assay Kit or other preferred method for protein determination...
  10. CRISPR Plasmids - Tagging

    Type
    Collection
    ...repair template for an individual tagging event. The kit contains 26 plasmids; 21 of the plasmids are for ...Jorgensen Lab SapTrap CRISPR/Cas Toolkit SapTrap is a modular toolkit from Erik Jorgensen's lab for building...targeting vector. Jorgensen Lab SapTrap CRISPR/Cas Toolkit Kanemaki Lab Auxin-Inducible Degron Tagging Masato...
  11. COVID-19 Resources

    Type
    Collection
    ... Addgene's Protocol for RNA Extraction Without A Kit Bloom lab - Protocol and Reagents for Pseudotyping...
  12. CRISPR Library Amplification

    Type
    Protocol
    ...Purify plasmid DNA using the Qiagen HiSpeed Maxi Kit (one conical is its own Maxiprep). Critical Do not...
  13. Cloning

    Type
    Guide
    ...website for easy to use MoClo and Golden Gate cloning kits for your next cloning project. Golden Gate Cloning...
  14. Immunology Research Plasmids and Resources

    Type
    Collection
    ... Additional Resources Plasmid Kits and Collections Human Kinase ORF Kit : 558 distinct human kinases and...growth factor-like protein 2 - KITLG KIT ligand DKFZp686F2250, KL-1, Kitl, MGF, SCF, SF, SHEP7 KL klotho...Root . Multiple Lentiviral Expression (MuLE) System Kit : A modular and flexible system that can be used ...infection from the lab of Ian Frew . MXS Chaining Kit : From the lab of Pierre Neveu , the MXS-chaining...applications in mammalian systems. The MXS-chaining kit includes chaining vectors with multiple cloning sites... inducible gene expression. Myristoylated Kinase Kit : Consists of 190 human kinases and kinase-related... Hahn , Matthew Meyerson , and David Root , this kit consists of 182 wild-type and 19 well-characterized...
Showing: 161 - 180 of 240 results