Skip to main content

We narrowed to 9 results for: Amh

Showing: 1 - 9 of 9 results
  1. Plasmids 101: How to Verify Your Plasmid Using a Restriction Digest Analysis

    Type
    Blog Post
    ...was digested with 2 unique enzymes (HindIII and BamHI) and run on an agarose gel. The resulting gel image...the plasmid is digested with either HindIII and BamHI alone (lanes 4-5), there is a single band of 7.3...plasmid. The double digest with both HindIII and BamHI (lane 3) produces bands at 6kb and 1.2kb (red box... star activity. Some endonucleases (for example BamHI) are capable of cleaving sequences which are similar...
  2. Addgene: The First Twenty Years

    Type
    Blog Post
    ...guide: https://www.addgene.org/guides/crispr/” — SirHamhands, responding to a request for “any suggestion ...
  3. MXS Chaining

    Type
    Blog Post
    ...SpeI and XbaI EcoRI and PstI Bglbricks BglII and BamHI EcoRI Additional Resources on the Addgene Blog...
  4. Synthetic Biology - Assembly Standards Guide

    Type
    Collection
    ...BglII Suffix: T GGATCC TAA CTCGAG Suffix Enzymes: BamHI , Xhol Scar: GGATCT Features: Scar encodes Gly-Ser...enzymes. Prohibited Restriction Sites: EcoRI, BglII, BamHI, XhoI For more info, visit iGEM: BglBrick – Berkeley...
  5. Immunology Research Plasmids and Resources

    Type
    Collection
    ..., AMGX AMH anti-Mullerian hormone MIF, MIS AMHR2 anti-Mullerian hormone receptor, type II AMHR, MISR2,... HHT2, ORW2, SKR3, TSR-I AMHR2 anti-Mullerian hormone receptor, type II AMHR, MISR2, MISRII BMP1 bone ...
  6. Sequencing Primers

    Type
    Guide
    ...CTTGGAGCCACTATCGAC In pBR322 tet region, upstream of BamHI site Forward pBRforEco AATAGGCGTATCACGAGGC In pBR322...GGTGATGTCGGCGATATAGG In pBR322 tet region, downstream of BamHI site Reverse pCAG-F GCAACGTGCTGGTTATTGTG Rabbit ...
Showing: 1 - 9 of 9 results