Skip to main content

We narrowed to 8 results for: Ecd

Showing: 1 - 8 of 8 results
  1. Transferable Skills Guide: Time Management

    Type
    Blog Post
    ...begin a task, you’re actively prioritizing. In my anecdote above, I prioritized splitting cells over meeting...the utility of your tasks. In my cell splitting anecdote, I probably could have grabbed some food with ...
  2. The Strength of Story Telling

    Type
    Blog Post
    ...Humans are designed to pay attention and enjoy anecdotal forms of information — identifying with a character...
  3. An Introduction to Adenovirus

    Type
    Blog Post
    ...measures were lifted (Servellita et al., 2023).  This anecdote goes toward saying that host-virus interactions...
  4. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...SV40 Alzheimer's Sohail Tavazoie 41848 psiCheck-ApoECDS APOE Luc SV40 Alzheimer's Sohail Tavazoie 42429...EIF2AK2 T7 VWM disease James Cole 42949 pBabePuro-ApoECDS APOE Alzheimer's Sohail Tavazoie 43908 pcDNAFLAG-ATM-kd...
  5. Sequencing Primers

    Type
    Guide
    ...GTGGTTTGTCCAAACTCATC SV40 polyA terminator Reverse Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC Drosophila heat...
Showing: 1 - 8 of 8 results