We narrowed to 23 results for: Gaa

...enzyme recognizing a broad range of PAMs like NG, GAA, and GAT, but also displaying increased editing specificity... NGG PAM. When they tested a variety of NG, GAT, GAA, and CAA PAMs, they saw that xCas9 3.7 cleaves multiple... efficiency), NGC (2.1-fold), NGA (1.6-fold) and GAA and GAT (5.2-fold). The low increase in NGA editing...in activating transcription. Sites containing NG, GAA, or GAT PAMs averaged 56-91% transcriptional activation... (37 vs 28%). Cytidine base editing at NGT, NGC, GAA, and GAT PAMs is improved, with a smaller increase...Construct NGG PAM NGA PAM NGC PAM NGT PAM GAA PAM GAT PAM xCas9 3.7 41 (1) 32 (1.6) ...

...SpCas9 VQR variant  3' NGAN or NGNG  xCas9 3' NG, GAA, or GAT SpCas9-NG 3' NG  Staphylococcus aureus...NNNNGATT  Streptococcus thermophilus (ST) 3' NNAGAAW  Treponema denticola (TD) 3' NAAAAC  The...

...the ability to target multiple PAM sequences (NG, GAA, and GT), greatly increasing the number of genomic...

...compared to SpCas9. xCas9 has a PAM requirement of NG, GAA, or GAT, making it a more flexible cutter with the...

...site (GAATTC) to the 5’ end of this primer, making our Forward Primer 5'-GAATTCATGTGGCATATCTCGAAGTAC-3'....Forward Primer will use the sequence 5'-ATGTGGCATATCTCGAAGTAC-3' for the region that binds the ORF and...final Forward Primer sequence of 5'-TAAGCAGAATTCATGTGGCATATCTCGAAGTAC-3'. For the Reverse Primer, the design...of the ORF, including the stop codon (5'-TGGCATATCTCGAAGTACTGA-3'), then adding NotI (GCGGCCGC) and then.... This gives us a sequence of 5'-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3' (30bp with 18bp of homology to...chose for our reverse primer (5’-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3’) into this calculator we get a...

...: Forward oligo: 5’- CACCGNNNNNNNNNNNNNNNNNNNGTTTGGGTCTTCGAGAAGACCTATTCXXXXXXXXC -3’; Reverse oligo: 5... 5’- AATTGXXXXXXXXGAATAGGTCTTCTCGAAGACCCAAACNNNNNNNNNNNNNNNNNNNC -3’, where NNN and XXX represent the ...

... with non-NGG PAM sequences include: xCas9 — NG, GAA, and GAT; increased nuclease fidelity SpCas9-NG —... SpCas9 VQR variant 3' NGAN or NGNG xCas9 3' NG, GAA, or GAT SpCas9-NG 3' NG Staphylococcus aureus (SA...3' NNNNGATT Streptococcus thermophilus (ST) 3' NNAGAAW Treponema denticola (TD) 3' NAAAAC Additional Cas9s...

...UGC Glutamine Gln Q CAA, CAG Glutamic Acid Glu E GAA, GAG Glycine Gly G GGU, GGC, GGA, GGG Histidine His...

...canonical loxP sequence is ATAACTTCGTATA-GCATACAT-TATACGAAGTTAT. The loxP sequence does not occur naturally ...

...NNNNRYAC Streptococcus thermophilus (St) NNAGAAW Treponema denticola (Td) NAAAAC ~20 additional...

...can try these new primers: EMX1-Forward: CCATCCCCTTCTGTGAATGT EMX1-Reverse: GGAGATTGGAGACACGGAGA Q16:...

... with non-NGG PAM sequences include: xCas9 — NG, GAA, and GAT; increased nuclease fidelity SpCas9-NG —... SpCas9 VQR variant 3' NGAN or NGNG xCas9 3' NG, GAA, or GAT SpCas9-NG 3' NG Staphylococcus aureus (SA...3' NNNNGATT Streptococcus thermophilus (ST) 3' NNAGAAW Treponema denticola (TD) 3' NAAAAC Additional Cas9s...

...half-site CACNA1F OZ507 and OZ508 OPEN OPEN gCGTGACCTCgctgatAAGAAGAGg xylt1 OZ509 and OZ510 OPEN OPEN cACCCTCTACaggacaGTAGCGGGTg...gACAGCCGTCtgcatctGGAGGTGCCc pitrm1 OZ515 and OZ516 OPEN OPEN cACCTGCAGCagattGAAGAAGAGg cftr OZ517 and OZ518 OPEN OPEN gTGCAACCGCagctttTAGGACGGAt...gCCCCTCAGCccagatgGGAGGAGATg dpf2 OZ531 and OZ532 OPEN OPEN cTGCTACTTCtggatGGAGAAACGa pitx2 OZ533 and OZ534 OPEN OPEN cCGCTTCAGCggtctGTGGACTCGa...Encephalopsin (Opn3) OZ541 and OZ542 OPEN OPEN aTCCATCCCAaacacatGTGGCAGAAt NFATc1 OZ543 and OZ544 OPEN OPEN aCCTCGCCTCagtgtGACGGAGGAc...Gene (sbds) OZ545 and OZ546 OPEN OPEN tGTTGCCGTCgtgagGATGAAGAAa CACNA1D (2of2) or cav1.3b OZ547 and OZ548...OZ548 OPEN OPEN gAGCTCCGTCtcgctgGCGGCCGAAg histamine receptor H3 (hrh3) OZ549 and OZ550 OPEN OPEN gCGCCACGGAcaataaaGAGGACTGCa...corepressor 2 OZ553 and OZ554 OPEN OPEN gCTCACCATCtgttggaTGCGATGGAa cdkn1a (p21) OZ555 and OZ556 OPEN OPEN...

...(Length) Common Variants Cre loxP ATAACTTCGTATAgcatacatTATACGAAGTTAT 13 bp inverted repeats + 8 bp spacer...site is widely used. Flp FRT GAAGTTCCTATTCCGAAGTTCCTATTCtctagaaaGTATAGGAACTTC 13 bp inverted repeats + 8... F3, F5, FRT14, FRT15 minimal FRT GAAGTTCCTATTCtctagaaaGTATAGGAACTTC Table 1. Summary of Cre, Dre, and...

...BioBrick (RFC 10) Prefix: GAATTC GCGGCCGC T TCTAGA G Alternate Prefix: GAATTC GCGGCCGC T TCTAGA TG (contains...Standard (RFC 25) Prefix: GAATTC GCGGCCGC T TCTAGA TG GCCGGC Alternate Prefix: GAATTC GCGGCCGC T TCTAG (for... 10) Back to Top BioBrick BB-2 (RFC 12) Prefix: GAATTC GCGGCCGC T ACTAGT G Prefix Enzymes: EcoR1 , NotI...Top BglBrick – Berkeley Standard (RFC 21) Prefix: GAATTC ATG AGATCT Prefix Enzymes: EcoR1 , BglII Suffix...21) Back to Top Silver Standard (RFC 23) Prefix: GAATTC GCGGCCGC T TCTAGA G Prefix Enzymes: EcoR1 , NotI...

...site (GAATTC) to the 5’ end of this primer, making our Forward Primer 5'-GAATTCATGTGGCATATCTCGAAGTAC-3'....Forward Primer will use the sequence 5'-ATGTGGCATATCTCGAAGTAC-3' for the region that binds the ORF and...final Forward Primer sequence of 5'-TAAGCAGAATTCATGTGGCATATCTCGAAGTAC-3'. For the Reverse Primer, the design...of the ORF, including the stop codon (5'-TGGCATATCTCGAAGTACTGA-3'), then adding NotI (GCGGCCGC) and then.... This gives us a sequence of 5'-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3' (30bp with 18bp of homology to...chose for our reverse primer (5’-TGGCATATCTCGAAGTACTGAGCGGCCGCTAAGCA-3’) into this calculator we get a...

...primers: FW 5'–GGTGACGGTGCTGGTTTA–3' RV 5'–TCGATGAATTCGAGCTCG–3' ID Plasmid Selectable Marker Tags Publication...

... 11546 EGFP-LC3 Autophagosomes LC3 EGFP Karla Kirkegaard 40827 mCherry-hLC3B-pcDNA3.1 Autophagosomes LC3...

...targeting RRE: forward primer: tgtgccttggaatgctagt probe (FAM): tttggaatcacacgacct reverse primer: aatttctctgtcccactccatc...

...Aurnhammer et al., 2012 ) fwd ITR primer, 5'-GGAACCCCTAGTGATGGAGTT rev ITR primer, 5'-CGGCCTCAGTGAGCGA ITR-...