Skip to main content
Addgene

We narrowed to 4 results for: Hrg

Showing: 1 - 4 of 4 results
  1. Channelrhodopsins with improved light sensitivity for minimally-invasive optogenetics

    Type
    Blog Post
    ...predictions.  Three top performers, named ChRger1, ChRger2, and ChRger3, were then characterized further by ...of an AAV expressing a ChRger. In both experiments, neurons expressing ChRgers produced stronger photocurrents...channelrhodopsins. Their new channelrhodopsins, called ChRgers, make the brain a little easier to access with ...allow for minimally-invasive optogenetics While ChRgers performed well in a tissue culture dish, that doesn...Therefore, the Arnold and Gradinaru Labs expressed ChRgers in mice to see if they were suited for in vivo ...invasive optogenetics. Both experiments delivered ChRgers by intravenous injection of PHP.eB, an AAV capsid...intracranial injections. When packaged in PHP.eB, ChRgers and ChR2(H134R) both reach the brain, but individual...
  2. Immunology Research Plasmids and Resources

    Type
    Collection
    ...GGF2, HGL, HRG, HRG1, HRGA, NDF, SMDF NRG2 neuregulin 2 Don-1, HRG2, NTAK NRG3 neuregulin 3 HRG3, pro-NRG3... NRG4 neuregulin 4 DKFZp779N0541, DKFZp779N1944, HRG4 NRP1 neuropilin 1 BDCA4, CD304, DKFZp686A03134, ...
  3. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...pAAV-AICD-NLS-IRES-hrGFP APP CMV Alzheimer's Helene Marie 107544 pAAV-AICD-NES-IRES-hrGFP APP V5 CMV Alzheimer's...Alzheimer's Helene Marie 107548 pAAV-syn-AICD-IRES-hrGFP APP hSyn1 Alzheimer's Helene Marie 107594 pCS2-sod1...
  4. Sequencing Primers

    Type
    Guide
    ...hormone terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP), forward ...
Showing: 1 - 4 of 4 results