We narrowed to 4 results for: Hrg
-
TypeBlog Post...predictions. Three top performers, named ChRger1, ChRger2, and ChRger3, were then characterized further by ...of an AAV expressing a ChRger. In both experiments, neurons expressing ChRgers produced stronger photocurrents...channelrhodopsins. Their new channelrhodopsins, called ChRgers, make the brain a little easier to access with ...allow for minimally-invasive optogenetics While ChRgers performed well in a tissue culture dish, that doesn...Therefore, the Arnold and Gradinaru Labs expressed ChRgers in mice to see if they were suited for in vivo ...invasive optogenetics. Both experiments delivered ChRgers by intravenous injection of PHP.eB, an AAV capsid...intracranial injections. When packaged in PHP.eB, ChRgers and ChR2(H134R) both reach the brain, but individual...
-
Immunology Research Plasmids and Resources
TypeCollection...GGF2, HGL, HRG, HRG1, HRGA, NDF, SMDF NRG2 neuregulin 2 Don-1, HRG2, NTAK NRG3 neuregulin 3 HRG3, pro-NRG3... NRG4 neuregulin 4 DKFZp779N0541, DKFZp779N1944, HRG4 NRP1 neuropilin 1 BDCA4, CD304, DKFZp686A03134, ... -
Neurodegeneration Plasmid Collection
TypeCollection...-AICD-NLS-IRES-hrGFP APP CMV Alzheimer's Hélène Marie 107544 pAAV-AICD-NES-IRES-hrGFP APP V5 CMV Alzheimer's...Alzheimer's Hélène Marie 107548 pAAV-syn-AICD-IRES-hrGFP APP hSyn1 Alzheimer's Hélène Marie 107594 pCS2... -
Sequencing Primers
TypeGuide...hormone terminator, reverse primer hrGFP-R TCCCCGAGTACCACTTCATC hrGFP (humanized Renilla GFP), forward ...