We narrowed to 140 results for: NUA
-
TypeBlog Post
-
Hot Plasmids and Viral Preps - January 2021
TypeBlog Post -
CRISPR Plasmids - CRISPR Transposases (CAST)
TypeCollection...Selectable Marker PI Publication Last reviewed on: January 30, 2025 Do you have suggestions for other plasmids... -
CRISPR Plasmids - Cascade-Cas3
TypeCollection...Insert Promoter PI Publication Last reviewed on: January 30, 2025 Do you have suggestions for other plasmids... -
Cre-Lox and Other Site-Specific Recombinases
TypeCollection... interpretation of your experimental results. Attenuated iCre(R297T), a point mutant iCre variant, reduces... -
Plan Your Experiment
TypeCollection...While there are some cases where it makes sense to manually design a gRNA, in most cases gRNA design software... -
Validated gRNA Sequences
TypeCollection...CCTCTTTGTCATCACGCTTC cut S. pyogenes 26789497 Corn AOC N. attenuata CAAAAGACTGTCAATTCCCT cut S. pyogenes 26479191 ... -
QC Sequencing Technologies at Addgene
TypeBlog Post... next. If all three attempts fail, the QC team manually checks and assembles the raw data. Addgene’s ...differences from the expected sequence, the QC team can manually revisit the assembly in a program called Geneious...length. Any mismatch or indel flags the sequence for manual review by one of our QC team members. This process...issue, the QC team developed a separate script for manually inputting known innocuous differences. This script... -
Tips for Getting a Faculty Position
TypeBlog Post... Eight years ago, I decided to write a "how to" manual on applying for faculty positions in biomedical...committee is different and needs to be told all of the nuances of the research in as technical of language as ...insights. After I wrote the first version of my manual, I added new chapters to incorporate the experiences...graduate students encouraged me to publish this manual and earn some cash for my expensive habits of running... -
5 Great Apps for Lab Life
TypeBlog Post...Gibco Cell culture manual and basic instructional videos. The search function in the manual just highlights...very helpful, but does make it easy to skim the manual. Overall, it’s a great tool for someone starting... -
Bacterial Toxin-antitoxin Systems as Molecular Biology Tools
TypeBlog Post...and inhibits MazF, is continually cleaved by the ClpAP protease so without continual production of MazE,...antitoxin is unstable, meaning that the cells must continually produce antitoxin to avoid cell death. In the... -
FLEx Technology and Optogenetics: Flipping the switch on gene expression with high spatial and temporal resolution
TypeBlog Post...The development and application of optogenetics." Annual review of neuroscience 34 (2011). PubMed PMID: ... view of cre-loxp site-specific recombination." Annual review of biophysics and biomolecular structure...Krook-Magnuson. "Specificity, versatility, and continual development: the power of optogenetics for epilepsy... -
#DeckTheLab with Tinsel and Test Tubes, Fa La La La La La La La La
TypeBlog Post... dusting off the winter coats and hats, and our annual Deck The Lab holiday decorating contest! Our #...#DeckTheLab, and tag @Addgene in the post! In January, Addgenies will vote on the entries in both the... -
Countdown to Halloween @Addgene
TypeBlog Post.... Our Halloween costume contests have become an annual tradition in which we choose our teams and start... we continue to have an amazing turnout for the annual Halloween costume, so I expect some great costumes... -
Keeping Up With CRISPR/Cas9
TypeBlog Post... in One-Cell Embryos. Niu Y, et al. Cell. 2014 January 30. (Pubmed) Programmable Removal of Bacterial ...CRISPR-Cas Systems. Ahmed A. Gomaa, et al. mBio. 2014 January 28. (Article). Read More: Other CRISPR Blog Posts... -
A Better Way to Get Customer Support: The Help Center
TypeBlog Post...reach you. As with all of our resources, we will continually update the Help Center to make sure that, whatever...rest of our services, you can bet that we’ll be continually improving the support we provide based on your... -
Communicating Your Science With Help From ComSciCon
TypeBlog Post...across the US and Canada convene at ComSciCon's annual flagship workshop. Our 2018 workshop took place...apply for our future events. In addition to this annual event, graduate students in different regional ... -
Viral Vectors 101: Viral Applications
TypeBlog Post... Therapeutic applications Vaccine development Attenuated and inactivated viruses pioneered vaccine development...Churchill MJ. Pathogenicity and immunogenicity of attenuated, nef-deleted HIV-1 strains in vivo. Retrovirology... -
Antibodies 101: Buffers, Storage, and Conjugates
TypeBlog Post... Chart. Boston University Flow Core. Retrieved January 31, 2022, from https://www.bu.edu/flow-cytometry...Syracuse University Flow Core Facility. Retrieved January 31, 2022, from https://flowcore.syr.edu/help/spectral-overlap... -
Synthesized by Ginkgo Bioworks, Shared by Addgene: SARS-CoV-2 Plasmids for Many Expression Systems
TypeBlog Post...protein variants are also available. Plasmids are continually added as they complete QC and you can find all...Sanger sequencing as a first pass QC. The lab team manually transforms, innoculates, and performs DNA minipreps...