Skip to main content
Addgene
Showing: 1 - 2 of 2 results
  1. Neurodegeneration Plasmid Collection

    Type
    Collection
    ... HA CAAX pMT2 CACNA1A HA Ad MLP Spinocerebellar ataxia 6 Annette Dolphin 206118 An CAAX pMT2 CACNA1A Ad...ataxia 6 Annette Dolphin 206112 Cav2.1 R57A, R59A pMT2 CACNA1A Ad MLP Spinocerebellar ataxia 6 Annette ...ataxia 6 Annette Dolphin 206119 An R57A, R59A CAAX pMT2 CACNA1A Ad MLP Spinocerebellar ataxia 6 Annette ...6 Annette Dolphin 206122 Cav2.1 EA2, R57A, R59A pMT2 CACNA1A Ad MLP Spinocerebellar ataxia 6 Annette ...ataxia 6 Annette Dolphin 206126 An R57A, R59A HA CAAX pMT2 CACNA1A HA Ad MLP Spinocerebellar ataxia 6 Annette...
  2. Sequencing Primers

    Type
    Guide
    ...major immediate-early protein (IE), forward primer pMT2-F TTGCCTTTCTCTCCACAGGT 3' end of synthetic intron...
Showing: 1 - 2 of 2 results