Skip to main content
Addgene
Showing: 1 - 20 of 58 results
  1. Fluorescent Tagging of Endogenous Genes with SapTrap

    Type
    Blog Post
    ...with SapTrap The Jorgensen Lab recently developed a modular plasmid assembly toolkit called SapTrap to ... improve CRISPR genomic tagging in C. elegans. SapTrap offers scientists a convenient one tube assembly...selection marker for screening modified strains. With SapTrap, the user first designs either oligos or synthetic...cloning, as digestion of the destination vector with SapI yields 2 sites- the first site accepts the sgRNA...site accepts the homology arm repair template. SapTrap includes a prebuilt donor plasmid library containing...homology arms). Digestion of the donor plasmids with SapI allows the tag, selectable marker, and connector...plasmids of the same type will produce the same unique SapI 5’ overhang, different combinations of connector...
  2. Plasmid Tools for Microbiome Studies

    Type
    Blog Post
    ...fluorescent protein (RFP) to a self-assembling protein (SAP) such as a bacteriophage shell protein or a bacterial...first induced with arabinose to begin expressing the SAP-RFP fusion. Then, the cells are washed to stop the...
  3. Plasmids 101: Restriction Cloning

    Type
    Blog Post
    ...phosphatase you choose. CIP (calf alkaline phosphatase) or SAP (shrimp alkaline phosphatase) are commonly used. ...
  4. Hot Plasmids: Winter 2025

    Type
    Blog Post
    ... up to 600 µm. Figure 3: ASAP5 for voltage imaging. A) ASAP5 selected for its improved kinetics...neurons expressing ASAP5-Kv. C) Cultured rat hippocampal neuron expressing pan-membrane ASAP5. Solid blue circle...the resting membrane potential, ASAP5 is a great new option. Find ASAP5 plasmids here! Hao, Y. A., Lee... The Lin Lab and collaborators recently created ASAP5, a faster and more responsive genetically-encoded...voltage indicator (GEVI) than previous versions. ASAP5 can be imaged using one- or two-photon microscopy...has remained difficult with GEVIs. Not only was ASAP5 able to detect mEPSPs, it also enabled imaging of... (Figure 3). The team also used AAV9 to deliver ASAP5 to the cortex and imaged voltage fluctuations in...
  5. Hot Plasmids - May 2022

    Type
    Blog Post
    ... microbial SSAPs (dCas9-SSAP) which insert genes in a cleavage free manner. The dCas9-SSAP system reports...editor using microbial SSAPs. Image from Wang, et al, 2022.  Find dCas9-SSAP plasmids here! Wang et...Cre-mediated AAV Targeted Evolution method (M-CREATE) dCas9-SSAP with reduced error rate for long sequence knock-...https://doi.org/10.1038/s41593-021-00969-4.   dCas9-SSAP with reduced error rate for long sequence knock-...Le Cong’s lab has developed a method using dCas9-SSAP to knock-in long sequences with reduced risks of...potentially be packaged into an AAV system. dCas9-SSAP will make the editing of kilobase-scaled sequences...
  6. Open Resources and Plasmid Tools For Studying C. elegans

    Type
    Blog Post
    ... interest.  SapTrap Tool Kit for CRISPR Cas9 edits At Addgene, we have the entire SapTrap toolkit from...from the Jorgensen lab. SapTrap is a reagent toolkit and plasmid assembly line for the creation of CRISPR...choosing (Schwartz and Jorgensen, 2016). Using SapTrap, this CRISPR plasmid can be created in a single...single tube. You can also find additional SapTrap plasmids used for introducing point mutations that was published... Schwartz, Matthew L., and Erik M. Jorgensen. "SapTrap, a toolkit for high-throughput CRISPR/Cas9 gene...PMC4905529.  Schwartz, M. L., & Jorgensen, E. M. "SapTrap vectors for introducing point mutations with unc...resources on the Addgene blog Learn more about SapTrap Read about CRISPR/Cas9 in C. elegans Browse our...
  7. Simple CRISPR-based Epigenetic Editing: dCas9-directed DNA Demethylation

    Type
    Blog Post
    ...post was contributed by guest blogger Daniel M. Sapozhnikov, a graduate student in the laboratory of Dr. ...leading to unpredicted gene expression changes (Sapozhnikov and Szyf 2021, Charlton et al. 2020). Most importantly...between DNA demethylation and gene expression (Sapozhnikov and Szyf 2021).    Figure 3: A simpler...leaving the target CpG unmethylated. Adapted from Sapozhnikov and Szyf 2021.   Let me leave you with a...  Thank you to our guest blogger!Daniel M. Sapozhnikov is a graduate student in the laboratory of Dr...1060–1065. https://doi.org/10.1038/nbt.3658. Sapozhnikov DM, Szyf M (2021) Unraveling the functional role...
  8. Summer SciComm: Preprints

    Type
    Blog Post
    ...Resources References ASAPbio, Preprint Resource Center: https://asapbio.org/preprint-info ASAPbio, Preprints and...applications. A number of organizations (such as ASAPbio) advocate for preprints, and a growing number of... Communication of COVID-19 research: https://asapbio.org/preprints-and-covid-19 Ettinger CL, Sadanandappa...
  9. Deep Dive: Fixing and Permeabilizing for Immunofluorescence

    Type
    Blog Post
    ...detergents, such as Triton X-100, Tween-20, or saponin. Each detergent has different chemical properties... and membrane integrity (Fig. 2). For example, saponin interacts with cholesterol in cell membranes and...) Permeabilizing with the selective detergent, saponin, keeps membrane-associated proteins in place, while...fixing with formaldehyde and permeabilizing with saponin. However, if you are not worried about washing ...
  10. An “elegans” Approach to Better CRISPR/Cas9 Editing Efficiency

    Type
    Blog Post
    ...development of toolkits such as the SapTrap CRISPR/Cas Toolkit and SapTrap-SEC kit for C. elegans genome engineering...repair template of your choosing. Tools such as SapTrap Builder greatly simplifies design of these constructs...genetics.114.170423 Schwartz ML, Jorgensen EM (2018) SapTrap vectors for introducing point mutations with unc...
  11. Antibody Validation for Flow Cytometry

    Type
    Blog Post
    ...found that some antibodies perform well in a PFA-saponin fixation and permeabilization protocol, but very...usually test 3 different fix/perms (methanol, PFA-saponin, PFA-triton). The fix/perm solutions can make a... your antibody. When compared, 4% PFA and 0.1% saponin; 4% PFA and 0.1% Triton X-100; and methanol, we... and fixed in 4% PFA and permeabilized in 0.1% saponin. 400,000 cells were stained with the indicated ...
  12. Hot Plasmids - October 2022

    Type
    Blog Post
    ...protein sequence of the predecessor GEVIs (called ASAP 1 and 2), they found an indicator that is optimized...-encoded voltage indicators (GEVIs) based on the ASAP sensors. The resultant JEDI-2P sensors overcome ...
  13. Experimenting with New Careers while in Grad School

    Type
    Blog Post
    ...months, and we got one submission. I was a bit disappointed in the lack of participation, but I decided ...was worried about becoming one of those angry, disappointed graduate students because I wasn’t sure what...
  14. 27 Hot Plasmids from 2016

    Type
    Blog Post
    ...lab from the University of Utah developed SapTrap. The SapTrap system uses golden gate assembly to produce...et al. Metab Eng. 2012. PubMed PMID: 2232647   SapTrap, a toolkit for high-throughput CRISPR/Cas9 gene...
  15. Validated gRNA Sequences

    Type
    Collection
    ...Depositor OCT4 H. sapiens CTCCCATGCATTCAAACTG 66989 cut S. pyogenes 26028531 Huangfu OCT4 H. sapiens multiple,...AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 58252 cut S. pyogenes 24870050 Goncalves AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT...AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT 50662 cut S. pyogenes 24336569 Sabatini AAVS1 H. sapiens GGGGCCACTAGGGACAGGAT...ASCL1 H. sapiens TGGATGGAGAGTTTGCAAGGAGC 64131 activate S. pyogenes 25619936 Sato ASCL1 H. sapiens TGGGCAGCCGCTCGCTGCAGCAG...ASCL1 H. sapiens TGGGGCTGGGTGTCCCATTGAAA 64129 activate S. pyogenes 25619936 Sato ASCL1 H. sapiens TGGTGTTTATTCAGCCGGGAGTC...ATF1 H. sapiens TAGGAATCAAACACTTTTATTGG 64690 tag S. pyogenes 26355004 Mendenhall ATM H. sapiens TGAATTGGGATGCTGTTTTT...AXIN2 H. sapiens TATGTTGGTGACTTGCCTCC 58782 cut S. pyogenes 24954249 Yamamoto BLIMP1 H. sapiens CGGATGGGGTAAACGACCCG...
Showing: 1 - 20 of 58 results